The DNA binding motif for many prokaryotic regulatory proteins, such as the lac repressor, is:

TLS Online TPP Program

#Question id: 356

#I Life Science/ Life Sciences Group – I-V

How does 0.5 M sucrose (molecular mass 342) solution compare to 0.5 M glucose (molecular mass 180) solution?

TLS Online TPP Program

#Question id: 1092

#SCPH28 | Zoology

Which of the following statements is true of steroid receptors?

TLS Online TPP Program

#Question id: 9242

#SCPH06 I Botany

Eutrophication is often caused by excess limiting-nutrient runoff from agricultural fields into aquatic ecosystems. This process results in massive algal blooms that eventually die and decompose, ultimately depleting the dissolved oxygen, killing large numbers of fish and other aquatic organisms. Predict which of the following human actions would best address the problem of eutrophication near agricultural areas?

TLS Online TPP Program

#Question id: 13096

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 2658

#SCPH06 I Botany

This condition in lac operon facilitates the condition of lac genes being transcribed at high levels