Practice Questions

TLS Online TPP Program

#Question id: 4144

The Wobble Hypothesis suggests that:

#SCPH01 Biochemistry

flexibility in base pairing occurs between the third base of a codon and the corresponding base in its anticodon
flexibility in base pairing only occurs for inosine as it can pair with U, C or A at its second position
flexibility in base pairing occurs between the second first base of a codon and the corresponding base in its anticodon
flexibility in base pairing only occurs for inosine as it can pair with U, G or A as its third position

More Questions

TLS Online TPP Program

#Question id: 17280

#SCPH05 I Biotechnology

During DNA isolation, phenol / chloroform extraction is performed to remove

TLS Online TPP Program

#Question id: 4328

#SCPH06 I Botany

Which of the following statements about the DNA in one of your brain cells is true?

TLS Online TPP Program

#Question id: 1606

#SCPH01 Biochemistry

transporter associated with antigen processing(TAP) is ,

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 66

#SCPH05 I Biotechnology

Which of the following statements regarding isomerism is incorrect regarding biomolecules?