You obtain 6 BACs (of known order, as shown below) and 7 STSs (of unknown order) that derive from a region of mouse chromosome 16 whose genomic sequence has not yet been finished.   

 

By PCR (using 20-bp primers at either end of each STS), you test each of the 6 BACs for the presence (+) or absence (-) of each of the 7 STSs. You obtain the following results:

 

Would you expect STS51 and STS52 to be present in BAC D? 

TLS Online TPP Program

#Question id: 5200

#SCPH28 | Zoology

What is the difference between a linkage map and a physical map?

TLS Online TPP Program

#Question id: 16086

#I Life Science/ Life Sciences Group – I-V

The preoptic region of the hypothalamus

TLS Online TPP Program

#Question id: 15912

#SCPH05 I Biotechnology

Match the items in Group 1 with an appropriate description in Group 2

Group 1                                                    Group 2

P. PSI-BLAST                                    1. ungapped, aligned motif

Q. CLUSTALW                                 2. Profiles

R. BLOCK                                         3. Heuristic method

S. FASTA                                           4. Multiple sequence alignment

TLS Online TPP Program

#Question id: 2955

#SCPH01 Biochemistry

Cyclin is to MPF as ............ is to cyclin-dependent kinases.

TLS Online TPP Program

#Question id: 13100

#SCPH05 I Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?