Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Question id: 10791

#SCPH05 I Biotechnology

Following are certain statements regarding furanocoumarins;

 a) furanocoumarins have an attached furan ring

 b) These compounds are toxic until they are activated by sunlight in the ultraviolet A (UV-A) region (320–400 nm)  

 c) Light activated furanocoumarins can insert themselves into the double helix of DNA and bind to the pyrimidine bases, thus blocking transcription and repair and leading eventually to cell death   

 d) Phototoxic furanocoumarins are especially abundant in members of the Umbelliferae family, including celery, parsnip, and parsley.

 Which of the following combination from the above statements is correct?

#Question id: 10792

#I Life Science/ Life Sciences Group – I-V

Compounds such as caffeic acid and ferulic acid occur in soil in appreciable amounts and have been shown,

#Question id: 10792

#SCPH05 I Biotechnology

Compounds such as caffeic acid and ferulic acid occur in soil in appreciable amounts and have been shown,

#Question id: 10793

#I Life Science/ Life Sciences Group – I-V

Hydroxyl groups (−OH),  and methoxy groups(−OCH3) modification provides colour variations in case of

#Question id: 10793

#SCPH05 I Biotechnology

Hydroxyl groups (−OH),  and methoxy groups(−OCH3) modification provides colour variations in case of

#Question id: 10794

#I Life Science/ Life Sciences Group – I-V

Which one of the following characteristics of about lignin is incorrect?