Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 52901
TLS Online TPP Program

#Question id: 18218

Which of the following is an incorrect statement about the terminologies related to protein sorting?

#SCPH01 Biochemistry
  1. Subcellular localization is an integral part of protein functionality
  2. Many proteins exhibit functions only after being transported to certain compartments of the cell
  3. All the proteins exhibit functions after being transported to certain compartments of the cell
  4. Protein sorting is also known as protein targeting
More Questions
TLS Online TPP Program

#Question id: 10571

#SCPH28 | Zoology

Uniform spacing patterns in plants such as the creosote bush are most often associated with
TLS Online TPP Program

#Question id: 22958

#SCPH01 Biochemistry

Which of the following statement is correct regarding to the flower development in Arabidopsis?
TLS Online TPP Program

#Question id: 5434

#SCPH06 I Botany

Plant height of wild Solanum nigrum is controlled by polygene. A pure line plant with 60 cm height was cross to pure line plant having 20 cm height .All F1 plant having uniform height 40 cm. F1 plant was allowed to self-fertilization to produced 4/64 proportional of F2 plant having height 20 cm . What is number of polygene governing plant height?
TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.
TLS Online TPP Program

#Question id: 611

#SCPH05 I Biotechnology

Which statement is false about the sequential theory of enzyme catalysis?