Menu

Previous Year Questions

Performance Meter

0%

TLS Online TPP Program

QUESTION ID:1

Apart from the interaction of antigenic peptide with the TCR-CD3 complex (signal 1 ), T-cell activation requires another signal termed as "Co-stimulatory signal" (signal 2). Given below are a few statements regarding the co-stimulatory signal.
A. All three professional antigen-presenting cells (dendritic cells, macrophages, and B cells) possess the same capacity in respect to delivering the co-stimulatory signal.
B. Co-stimulatory signals are not antigen-specific.
C. The principal co-stimulatory molecules expressed on antigen presenting cells are B7 -1 and B7-2.
D. Unlike B7, CD28, the ligand for B7 which is expressed on T cells, is not a member of immunoglobulin superfamily.
Which of the above statement(s) is/are NOT true?

QUESTION ID:2

Some of the statements given below are related to species that show r- or k-selection strategies:
A. Maximum rate of increase of a population
B. Density of individuals supported by the environment at equilibrium
C. Life history evolution
D. Liebig's law of the minimum
E. Precociality and altriciality
Choose the option that contains all the correct statements related to r- and k-selection strategies

QUESTION ID:3

Given below are statements regarding the specialized embryonic structure of the grass family:

A. The scutellum forms the interface between the embryo and the starchy endosperm tissue.

B. Coleorhiza protects and covers the first leaf while buried in the soil.

C. Coleoptile forms a protective sheath around the radicle.

D. In some species such as maize, the upper hypocotyl has been modified to form a mesocotyl.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:4

Which one of the sequences given below is a portion of a potential microRNA precursor?

QUESTION ID:5

Which one of the following options correctly depicts the stereo-conformation of the dipeptide derivative of Aspartic acid and Phenylalanine? 

QUESTION ID:6

Following statements are made about DNA base excision repair (BER):
A. BER process begins with a DNA glycosylase, which extrudes a base in a damaged base pair, then clips out the damaged base.
B. In bacteria, DNA polymerase Ill fills in the missing nucleotide in BER.
C. Eukaryotic apurinic/apyrimidinic (AP) endonuclease (APE1) performs proofreading activities.
D. APE1 possesses 5 → 3 exonuclease activity
Which one of the following options shows combination of all correct statements?

QUESTION ID:7

Changes in cancer-critical genes/proteins in different human tumours were analyzed. Gene amplification or deregulation leads to increased expression (X) while mutations, deletions, or recombination leads to inactivation (Y)

Column X


Column Y

A

E-cadherin, Smad4, Ras, Myc

i

PTEN, APC, AKT, Her2

B

AKT, Ras, Myc, Her2

ii

PTEN, E-cadherin, APC, Smad4

C

AKT, Ras, Myc, Smad4

iii

PTEN, E-cadherin, APC, Her2

D

E-cadherin, AKT, Ras, Myc

iv

Her2, PTEN, APC, Smad4

Which combination of X and Y is most likely to be found in the tumours?

QUESTION ID:8

Given below is a table listing selected extant molluscs (Column X) and a range of eye complexities (Column Y) found in them


Column X

Column Y

A. Limpet

i. Complex camera lens-type eye

B. Marine snail

ii. Eyecup

C. Nautilus

iii. Eye with primitive lens

D. Squid

iv. Patch of pigmented cells

v. Simple pinhole eye

Which one of the following options represents the correct match between Column X and Column Y? 

QUESTION ID:9

The following statements are made regarding diverse strategies adopted by fungal pathogens:
A. HC toxin inhibits histone deacetylase of the host plant.
B. Oxalic acid produced by fungal pathogens suppresses early plant defense responses.
C. Oxalic acid produced by fungal pathogens induces callose deposition in the infected tissues.
D. HC toxin targets plasma membrane-localized H+-ATPase in the host plant.
Which one of the following options represents all correct statements?

QUESTION ID:10

Lung surfactant is composed of phospholipids and proteins and plays an important role in lowering the surface tension of alveoli when they are small in size. The following statements suggest the structure and functions of proteins in lung surfactant:
A. Surfactant protein B (SP-B) and surfactant protein C (SP-C) are the key protein members of monomolecular film of surfactant.
B. Surfactant protein A (SP-A) is a large glycoprotein and has a collagen like domain within its structure.
C. SP-A does not play any role in the feedback uptake of surfactant by the type II alveolar epithelial cells.
D. The formation of phospholipid film lining the alveoli is inhibited by the proteins in surfactant
Which one of the following options represents the combination of correct statements?

QUESTION ID:11

A knock-in cassette was constructed in order to introduce the j3-casein gene in an animal cell. The viable clones were selected using a double-marker system, with G418 (neomycin analog) and ganciclovir. Identify the correctly designed cassette from the options given below. (SoH - sequence of homology; Gol - gene of interest; neo' - neomycin resistant; tk - thymidine kinase)

QUESTION ID:12

Consider a disease caused by a recessive allele. In a study population, one out of every 500 individuals (0.20%) has the disease. Based on the Hardy-Weinberg equation, what is the percentage of individuals who are carriers of the recessive allele for the disease?

QUESTION ID:13

A cross was carried out between two strains of Neurospora carrying alleles 'A' and 'a', respectively. The cross led to the following octad patterns. The numbers in the last row indicate the number of octads observed with the given pattern
In what percentage of meiocytes did segregation occur at Anaphase II? 

QUESTION ID:14

Two teams of researchers (I and II) extracted chromatin from nuclei and examined them with an electron microscope. The Team I found that isolated chromatin resembles beads on a string. In contrast, Team II found that isolated chromatin appears as a condensed fiber of 30 nm in diameter
Given below are a few reasons for these different outcomes
A. Team I isolated the chromatin with low-ionic-strength buffer, and Team II isolated chromatin with an ionic strength of ~0.15M KCI (physiological ionic strength).
B. Team I isolated the chromatin with ~0.15M KCI and Team II did it with a low-ionic-strength buffer.
C. For Team II, the nuclear isolation method was not appropriate, and they had contamination from the cytoplasmic pool, leading to the appearance of the chromatin as a condensed
fiber.
D. Team I chromatin got sheared during isolation, thus giving the appearance of beads on a string.
Among the statements given above, which statemenUs most appropriately defines the divergent outcomes of Team I and Team II?

QUESTION ID:15

The critical micellar concentration (CMC) of a detergent is 5 mM. Choose the option that uses the minimum amount of detergent that can be used for cell lysis and is least likely to denature soluble proteins?

QUESTION ID:16

Following table shows cultivated crops (Column X) and the continents where their centers of origin (Column Y) are situated:

Column X

Column Y

A. Coffee

i. South America

B. Pineapple

ii. Africa

C. Banana

iii. Asia

D. Rubber

Which one of the following options represents the correct match between column X and column Y?

QUESTION ID:17

Endothelial cells which form the innermost layer of blood vessels secrete many vasoactive substances. The formation and functions of some of these vasoactive substances are proposed in the following statements:
A. Prostacyclin produced by the endothelial cells promotes vasoconstriction.
B. Inhibitors of the cyclooxygenase increase the production of prostacyclin.
C. When endothelial cells are stimulated by acetylcholine or serotonin, nitric oxide (NO) is released that causes relaxation of vascular smooth muscle.
D. NO is short-lived and inactivated by haemoglobin.
Which one of the following options represents the combination of correct statements?

QUESTION ID:18

Some of the sequence of events involved in phototransduction in rod cells upon illumination are given below:
A. Hyperpolarization
B. Activation of phosphodiesterase
C. Decreased release of synaptic transmitter
D. Activation of transducin
E. Decreased intracellular cGMP
F. Conformational change in rhodopsin
Choose the correct sequence of events in visual transduction during light perception

QUESTION ID:19

The loci for three mutations on X-chromosome, yellow body colour (y), cross-vein less (cv), and forked bristles (f) are shown below in the map

The interference between these genes is zero. A male fly with yellow body, cross-vein less and forked bristles was crossed with virgin female flies homozygous for the wild type phenotype. The F1 flies were sib-mated and a total of 1000 F2 progeny flies were obtained.

Which one of the following options represents a correct conclusion from the analysis of F2 progeny?

QUESTION ID:20

If the length of a single continuous a-helical polypeptide is 108 A, which one of the following statements is true?

QUESTION ID:21

Following statements are made regarding the plant hormones, Gibberellins.
A. Gibberellins are ubiquitous in plants and are also present is several fungi.
B. GA1 is the most abundant gibberellin produced in the fungus Fusarium fujikuroi.
C. The exogenous application of gibberellin, GA3 stimulates dramatic stem elongation in the dwarf maize mutant but has little effect on the tall, wild-type plant.
D. The application of exogenous gibberellins causes upregulation of the GA20 oxidase and  GA3 oxidase genes.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:22

Given below are inhibitors of electron transport (Column X) and their target enzymes (Column Y)



Column X


Column Y


Inhibitors of electron transport


Respiratory chain complex enzymes

A

Dicyclohexylcarbodiimide and Oligomycin

i

NADH coenzyme Q reductase

B

Rotenone and Demerol

ii

ATP Synthase

C

Thenoyltrifluoroacetone and Carboxin

iii

Succinate coenzyme Q reductase

D

Cyanide and Azide

iv

Cytochrome c oxidase

Which one of the following options represents all correct matches between Column X and Column Y

QUESTION ID:23

Western Ghats of India is considered as one of the global biodiversity hotspots because of some of the following characteristics:
A. High species richness
B. High endemism
C. Habitat loss
D. Large altitudinal range
Which one of the following options represents the correct combination of characteristics that qualifies the Western Ghats as a biodiversity hotspot?

QUESTION ID:24

Bicoid was identified as a head morphogen in Drosophila and embryos lacking Bicoid could not form a head. In an experiment, bicoid mRNA was introduced in different regions of bicoid-deficient (bed·) or wild type embryos and development of the head and tail (as indicated by arrows) was followed


Which one of the following options represents the correct developmental pattern? 

QUESTION ID:25

Column X enlists some of the common animal viruses and column Y enlists cell surface proteins that serve as their receptors.

Column X

Column Y

A. Hepatitis A virus

i. Immunoglobulin superfamily

B. Rotavirus

ii. Acetylcholine receptor on neurons

C. Polio virus

iii. Alpha 2-macroglobulin

D. Rabies virus

iv. Acetylated sialic acid on glycoprotein

Which one of the following options represents the correct match between columns X and Y? 

QUESTION ID:26

An ancestral sequence (TT AG) has diverged into two sequences and has since accumulated nucleotide substitutions along two lineages (1 and 2)

Match the type of substitutions observed in the two sequences with their correct names:

QUESTION ID:27

Nutrients are gained or lost by ecosystems in a variety of ways. These nutrients may accumulate in different organic or inorganic pools over time. The different pools of phosphorus are
i. Mineral inorganic phosphorus
ii. Labile (available) phosphorus
iii. Occluded inorganic phosphorus
iv. Soil organic phosphorus
v. Plant organic phosphorus
The following graph shows the generalized change in phosphorus dynamics during primary succession: 
Which one of the following options correctly matches the region (A to E) shown in the graph to the phosphorous pool? 

QUESTION ID:28

The functional connection between the cell body of neuron and its axonal terminal is achieved by axonal transport. Some features of axonal transport are suggested in the following statements:
A. Orthograde transport occurs from the axonal terminal to the cell body.
B. Orthograde transport has two components - fast axonal transport and slow axonal transport.
C. The rate of orthograde fast axonal transport is higher than that of retrograde transport.
D. The molecular motor dynein is required for orthograde transport while kinesin is molecular motor for retrograde transport.
Which one of the following options represents the combination of correct statements?

QUESTION ID:29

Microtubule cytoskeleton utilizes some accessory proteins to regulate microtubule dynamics. Accessory proteins are given in column X and their typical functions in column Y

Accessory protein (Column X)

Function (Column Y)

A. γ-TuRC

(i) stabilizes plus end, promotes rapid microtubule growth

B. XMAP215

(ii) helps in microtubule branching

C. Katanin

(iii) nucleates assembly and remains associated with the minus end

D. Augmin

(iv) severs microtubules

Which one of the following options represents all correct matches between Column X and Column Y? 

QUESTION ID:30

The gametophytes of liverworts have the following types of apical cells, which contribute to different thallus forms:
A. Tetrahedral
B. Cuneate
C. Lenticular
D. Hemidiscoid
Which one of the following options correctly states the number of cutting faces (planes) each apical cell type has?

QUESTION ID:31

The figure given below is of two homologous chromosomes paired during meiosis where one event of recombination occurred between two homologues: 

The following interpretations were made:

A. The individual is heterozygous for an inversion

B. The figure depicts a paracentric inversion

C. After recombination at Anaphase I a dicentric and an acentric chromosomes will be formed

D. At Anaphase II the recombinant chromatids will have large deletion or duplication

E. Inversions are often considered as crossover suppressors because crossover product does not survive

Which one of the options given below has all correct answers:

QUESTION ID:32

Synthesis of thyroid hormones (T 3 and T4) takes place in a highly intricate manner in the thyroid gland. Following statements are made regarding synthesis of these hormones
A. Iodine enters the thyroid follicular cells through a transporter
B. Thyroid hormone synthesis takes place outside the follicular cells in the follicular colloid
C. Thyroglobulin glycoprotein is composed of four large subunits
D. Thyroglobulin glycoprotein is composed of two large subunits
Which one of the following options has the combination of correct statements?

QUESTION ID:33

Following statements were made for fragile X syndrome:
A. It is caused due to increased numbers of CGG trinucleotide (>200 repeats) in the 5' UTR of FMR1 genes.
B. Unaffected people do not show any CGG repeats in the 5' UTR of the FMR1 gene.
C. Expanded numbers of CGG repeats in 5' UTR of FMR1 transcripts causes its premature degradation.
D. Expansion over 200 repeats leads to methylation of the FMR1 promoter.
E. Fragile appearance of X chromosome develops due to dissociation of non-histone proteins from the FMR1 locus.
Which one of the following options provides combination of all correct statements?

QUESTION ID:34

The following steps/events represent the pathway of presenting extracellular pathogen to cytotoxic T cells:
A. Fusion of endosome membrane with the virus and escape of RNA and protein in the cytosol.
B. Assembly of class I MHC protein with bound viral peptide in Golgi apparatus.
C. Proteolysis of viral proteins by the proteasome.
D. Binding of the peptide to a chain and stabilization of the assembly of a chain and ~2- microglobulin.
E. Recognition of viral peptide by cytotoxic T cell.
Which one of the following options is the correct sequence of events?

QUESTION ID:35

The eukaryotic mRNA shown schematically in the diagram below has five ribosomes carrying out translation



Which one of the following statements about this polyribosome complex is true?

QUESTION ID:36

Following are certain statements regarding the plant cell water potential (1J1):
A. The major factors influencing the water potential in plants are potentials of solutes ('l's), pressure (\Vp) and gravity ('l'9).
B. The solute potential (1J1s) increases the free energy of water by diluting the water.
C. Positive pressures raise the water potential while negative pressures reduce it.
D. The gravitational potential depends on the height of the water above the reference-state of water, the density of water and the acceleration due to gravity.
Which one of the following options represents all correct statements?

QUESTION ID:37

The following DNA molecules are provided as substrates for replication by DNA polymerase Ill

Which one of the following options lists the molecules that CANNOT function as substrates for DNA polymerase Ill?

QUESTION ID:38

Newly identified proteins X, Y, and Z are associated with endoplasmic reticulum (ER) membrane fraction. The above ER membrane fraction is subjected to high salt treatment {buffer pH 7.4, 0.5 M KCI) followed by fractionation by centrifugation into soluble and insoluble pellet
components. The following observations were made from the above experiment:
i. The proteins X and Y are fractionated into soluble components.
ii. Protein Z is fractionated into insoluble pellet components.
Based on these observations, the following inferences are made:
A. Proteins X and Y are peripheral membrane proteins
B. Protein Z is an integral membrane protein
C. Protein Z is a peripheral membrane protein
D. Proteins X and Y are integral membrane proteins
Which one of the following options represents the combination of all correct statements?  

QUESTION ID:39

Columns X and Y list the terms associated with gametogenesis and fertilisation


Column X


Column Y

A

Primordial germ cells

i

Luteinizing hormone

B

 Dictyate resting stage

ii

Posterior epiblast

C

 Sodium channels

iii

Male pronuclei

D

 Protamines

iv

Block polyspermy

Which one of the following options represents all correct matches?

QUESTION ID:40

Angiosperms have witnessed evolutionary changes which includes a few apomorphies. Which one of the following options depicts the correct apomorphy/apomorphies that has/have evolved in Eudicots?

QUESTION ID:41

The reproductive cycles of two populations (X and Y) of the silk cotton tree ( Ceiba pentandra) were monitored for one year. A census was carried out and all plants were tagged and counted throughout this period and is reflected in the data sheet given below

Parameter

Population X

Population Y

Initial number of plants (N0​)

500

300

Number of new seedlings established (B)

100

210

Number of initial plants that died (D)

20

27

Given that there is no seedling mortality, which one of the options correctly depicts the per capita rate of increase (r) for the two populations?

QUESTION ID:42

As depicted in the figure below, the sequence of trypanosomal mitochondrial cytochrome oxidase subunit II (COX 11) mRNA does not match the sequence of the COX II gene. The mRNA contains four additional U's (highlighted) which are not represented by 'T's in the gene, and these four U's are presumably added to the RNA by editing
COX II DNA: ... GT AT MAAGT AGA G A ACCTGG···
COX II RNA: ···GUAUMAAGUAGAUUGUAUACCUGG···
The following statements were made about RNA editing:
A. RNA editing can add or remove U's from the target mRNA.
B. Editing occurs in the 5' - 3' direction by successive action of one or more guide RNAs.
C. A terminal uridylyl transferase (TUTase) facilitates addition of extra UMPs (urldylates) to the mRNA during editing.
D. The proteins required for editing are encoded by the mitochondrial DNA, while the required guide RNAs are encoded in the nucleus and imported into the mitochondria.
Which one of the following options shows the combination of all correct statements?

QUESTION ID:43

Certain statements are made below regarding radio-receptor assay technique
A. It is a competitive protein binding method.
B. It is a non-competitive protein binding method.
C. Radiollgand is present in excess of unlabelled ligand.
D. Unlabelled ligand is present in excess of radioligand.
E. Activated charcoal incubation and further centrifugation lead to separation of free ligand in the charcoal pellet.
F. Activated charcoal incubation and further centrifugation lead to separation of bound ligand in the charcoal pellet
Which one of the following options is the combination of all correct statements?

QUESTION ID:44

Given below is a DNA sequence:
5' - ATGCGATGACGATTGACGATGACGATAGAC - 3'
In the absence of any other affecting parameters such as length, Tm, GC-content, which one of the following combinations of PCR primer sequences would be able to amplify the above fragment?

QUESTION ID:45

The table given below contains some of the classes of phylum Arthropoda in Column X and their characteristic head structures in Column Y


Column X


Column Y

A.

Arachnida

i.

Head is distinct with a pair of compound eyes, a paired antennae, a paired mandibles and a paired maxillae

B.

Crustacea

ii.

Head is distinct having a pair of simple eyes, paired antennae and paired mandibles

C.

Myriapoda

iii.

Five segmented head with two pairs of antennae, two pairs of maxillae and one pair of mandibles

D.

Insecta

iv.

Cephalothorax with two chelicerae, two pedipalps

Which one of the following options represents the correct match between Column X and Column Y? 

QUESTION ID:46

Following statements are made regarding heterosis breeding in plants.
A. Heterosis is always lowest in a cross between two genetically diverse parents.
B. Cytoplasmic Male Sterility (CMS) may be used in heterosis breeding to eliminate emasculation.
C. The A-line (CMS) and B-line (used for maintenance of CMS) are isogenic lines, differing at only a specific locus.
D. Heterosis can be retained in the F2 generation.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:47

Yeast two-hybrid system allows detection of interacting proteins. In the following schematic, various components of yeast two-hybrid system have been indicated by letters A-F.

Which one of the following options provides a correct match of A to F and components of yeast two-hybrid system? 

QUESTION ID:48

The table below lists terminologies (column X) and concepts (column Y) related to ecological niche


Column X


Column Y

A

Niche complementarity

i

Species distribution explained by trophic levels and biotic interactions.

B

Niche packing

ii

Tendency for coexisting species which occupy a similar position along at least one niche dimension.

C

Community niche

iii

Tendency for coexisting species to fill the available space along important niche dimensions.

D

Eltonian niche

iv

Composition of niches of all individual species niches that co-occur at the same site.

Which one of the following options represents the correct match between column X and column Y?

QUESTION ID:49

Certain animal species use infrasound for acoustic signaling. In this context, consider the statements below:
A. lnfrasound signals propagate over several kilometers in deserts
B. lnfrasound signals propagate over several kilometers in open oceans
C. lnfrasound is employed only by mammals for acoustic signaling.
D. lnfrasound signal transmission is prone to scattering and attenuation
Which one of the following options represents all correct combination about infrasound signaling?

QUESTION ID:50

The melting curves shown below are of two double-stranded DNA molecules of the same length

Which one of the following statements about these DNA molecules is correct?

QUESTION ID:51

Protein transport into the ER is co-translational and proteins are inserted via an aqueous channel into the ER. This can be studied using microsomes in an in vitro translation set up. Statements given below are possible outcomes when salt conductance is measured in this system.
A. Microsomes do not show any conductance of salt ions when isolated from the cells.
B. Addition of puromycin will lead to increased salt conductance.
C. Addition of puromycin will have no effect on salt conductance.
Which one of the following options has the combination of all correct statements?

QUESTION ID:52

The following statements are made regarding the defense signaling pathways locally activated following pathogen infection or pest attack
A. When JA1LE levels rise, the JAZ proteins interact with COl1 protein and get degraded by 26S proteasomal pathways.
B. Elevated reactive oxygen species levels enhance SA-mediated defense signaling.
C. Under normal (uninfected) conditions, NPR1 is preferentially localized into the nucleus
D. Gibberellic acid and abscisic acid cannot participate in plant defense signaling
Choose the option with all correct statements:

QUESTION ID:53

The table below represents plant disease resistance genes, the protein type and race-specific nature:

Disease resistance gene

Protein type

Race-specific nature

A. edr1

a. subunit of the general transcription factor TFIIA

i. yes

B. mlo

b. Raf-like MAPKKK

ii. no

C. xa5

c. a member of the NODULIN3 gene family of SWEET proteins

D. xa13

d. plant-specific seven transmembrane helices protein

Choose the correct combination of disease resistance gene, its protein type, and race-specific nature from the options given below.