Menu

Previous Year Questions

TLS Online TPP Program

QUESTION ID:1

The sum of squares of four integers

QUESTION ID:2

Six years ago, the ages of three persons were in ratio 3:5:8. If the sum of their ages 8 years from now would be 122, what are their present ages (in years)?

QUESTION ID:3

What is the difference, 11 hours after synchronisation, in the time shown by a standard watch and a watch whose hour and minute hands coincide every 64 minutes?

QUESTION ID:4

The shape of a country on a map is approximated by a kite with diagonals of length 300 km each. The minimum possible length of its boundary will be closest to

QUESTION ID:5

Symbols 8 , ©. 0 represent mathematical operations (out of +, - , + , x)
which respect the relations
80589 = 53
9 83 © 2 = 25
What is the value of 2 © 13 0 7 ?

QUESTION ID:6

In an examination 3 medals were awarded for each of 5 subjects. If threecandidates won exactly four medals each, and no candidate won just one medal, the total number of medal winners

QUESTION ID:7

Which one of the following graphs represents the displacement vs time relation for the motion of a ball thrown upward and returning1 toward the ground, remaining in air for 1 O seconds? (Ignore air resistance.)

QUESTION ID:8

The population of a species (y) changes with the month (x) as shown in the graph. Which of the following equations best describes the population curve?

QUESTION ID:9

On day 1, a boy puts one coin in his piggy bank. On successive days he addscoins so as to double the number of coins. In another piggy bank, a girt puts 2coins on day 1 but adds coins on every alternate day so as to double thenumber of coins. On which day will they put the same number of coins in their piggy banks?

QUESTION ID:10

If ab = 5, be= 7 and ca = 11, which of the following identities is valid?

QUESTION ID:11

Suppose each of my brothers has the same number of children as I have sisters, each of the sister having the same number of children as I have brothers. If my siblings have a total of 12 children, none of them an only child, the number of my siblings is

QUESTION ID:12

A circular disk of unit radius rolls along a straight line from P to Q

Which of the following figures shows the orientation of the disk at Q?


QUESTION ID:13

Four students Adil, Billy, Ramesh and Diana joined a college in 1991, 1992, 1993 and 1994 but not necessarily in that order. Each student joined one of the four departments, viz. Physics, Chemistry, Mathematics and Biology. No twostudents joined the same department. One of those who joined the college before 1993 joined Chemistry. No one joined the college after Ramesh. Diana joined Physics. Adil joined one year after Diana but didn't join Chemistry.Who joined the college in the year 1993?

QUESTION ID:14

In the following finite sequence of integers, how many 9s are divisible by the integers immediately preceding them?
8,3,4,9,3,5,9,5,9,9,9,4,5,9,5,6,3,3,5,7,2,3,9,9,8,9,3,9.1.9,4

QUESTION ID:15

In a grid puzzle, each row and column in the 9x9 grid, as well as each 3x3 subgrid shown with heavy borders, must contain all the digits 1- 9.

In the given partially filled grid, the digit in the square marked "?" is

QUESTION ID:16

In the given triangle ABC, a square is drawn as shown. Given, LBAC = 90°, BC = a, BO= x and EC= y; which of the following is the area of the square?

QUESTION ID:17

A rectangular paper of sides in the ratio 3:4 is folded in half across the longer side. The process is repeated several times. After how many foldings will the ratio of the sides be 3:4? (Ignore the finite thickness of the· paper.)

QUESTION ID:18

Vehicle number plates have two letters out of the 26 letters of the English alphabet followed by four decimal digits. How many different number platesare possible if repetition of letters and digits is allowed?

QUESTION ID:19

The number 68132 - 31932 is divisible

QUESTION ID:20

A test consists of 20 questions. A correct answer fetches 4 marks and a wrong answer is penalised by deducting 1 mark. Unattempted questions fetch nothing. If a candidate with a few wrong answers secures 44 marks, how many questions were attempted?

QUESTION ID:21

Column X represents the type of junctions and column Y represents the proteins associated with the junctions

Which one of the following options is a correct match between terms of Columns X and Y?

QUESTION ID:22

Which one of the following statistical methods compares the means of the populations?

QUESTION ID:23

In a mutagenesis experiment, the following pedigree was obtained. All progeny had the same phenotype.
The mutation is most likely to have occurred

QUESTION ID:24

Which one of the following options lists landmasses that were all a part of the ancient Gondwana supercontinent?

QUESTION ID:25

Which one of the following statements regarding the developmental potential of cells in embryo is INCORRECT?

QUESTION ID:26

Which one of the following enzymes does NOT cataiyze the oxidation of substrate by reducing the electron acceptor, NAD+?

QUESTION ID:27

Which one of the following correctly shows the total estimated biomass of the lifeforms on Earth given here, in increasing order?

QUESTION ID:28

Which one of the following techniques allows the study of all three types of interactions namely, protein:protein, protein:DNA, and protein:RNA?

QUESTION ID:29

Select the species that was thought to be extinct because of climate change and habitat loss, but was recently rediscovered in the year 2022

QUESTION ID:30

Which one of the following statements is INCORRECT regarding plant phytochrome (PHY), cyanobacterial phytochrome1 (Cph1 ) and bacterial phytochrome like protein (BphP)?

QUESTION ID:31

During replication, over-winding of DNA is caused by __ and removed by

QUESTION ID:32

Which one of the following statements about distribution of chromosomes within the interphase nucleus of a mammalian cell is correct?

QUESTION ID:33

RNA polymerase is an enzyme that transcribes DNA sequences into RNA. Which one of the following is NOT a property of the RNA polymerase?

QUESTION ID:34

In the production of alcohol by fermentation, in the absence of oxygen, yeasts convert glucose to pyruvate and pyruvate to ethanol. Fermentation promotes glycolysis by

QUESTION ID:35

During animal cell culture, which one of the following cell types would NOT require trypsin for passaging?

QUESTION ID:36

Which one of the following statements is correct for dosage compensation in human?

QUESTION ID:37

Phosphatidylinositol (Pl) is unusual among membrane lipids because it can undergo reversible phosphorylation at multiple sites on the inositol head to generate a variety of phosphorylated Pl lipids called phosphoinositide. In a cell signaling event, the enzyme that directly converts Pl(4,5)P2 to Pl(3,4,5)P3 is:

QUESTION ID:38

Fifteen spontaneous Ara- mutants of E.coli that were not able to utilizearabinose as a sole carbon source in minimal synthetic medium at42°C were isolated. However, interestingly all these mutants were able touse arabinose as the sole carbon source at 30°c . Based on the aboveinformation, which one of the following options represents the most likely type of the mutations?

QUESTION ID:39

Which one of the following terms describes the biological classification system based on common ancestry?

QUESTION ID:40

Sperm __ , which helps in penetration of the egg during fertilization in mammals, contains __

QUESTION ID:41

Which one of the following is involved in the pinching-off of the neck of invaginating coated pit to form endocytotic vesicle att the pre-synaptic terminal?

QUESTION ID:42

Which one of the following four plant families has the largest number of species?

QUESTION ID:43

In the model plant Arabidopsis thaliana, methionine is a precursor amino acid in the biosynthesis of

QUESTION ID:44

Kaposi's sarcoma is caused by
1. Epstein-Barr virus
2. HIV and HHV-8
3. HTLV type1

QUESTION ID:45

Which one of the following geological events in the Cretaceous had a massive impact on the climate and biodiversity of India?

QUESTION ID:46

The pH of endocytic vesicles is 5.2, and the pH of gastric juice is 2.0. The endocytic vesicle has a [H+] that is

QUESTION ID:47

Which one of the following is referred to as tuberonic acid?

QUESTION ID:48

What type of electromagnetic radiation is used in biomolecular NMR spectroscopy?

QUESTION ID:49

Which one of the following functions is NOT facilitated by a tmRNA?

QUESTION ID:50

Monogamy in sexually reproducing animals is seemingly paradoxical given that males must maximise their number of matings for higher fitness. Yet,many birds are known to be monogamous. Which one of the followingstatements represents a scenario where monogamy in birds is LEAST likely to evolve?

QUESTION ID:51

Porins, which are normally present on the outer mitochondrial membrane, reach their destination by

QUESTION ID:52

One strand of a palindromic dsDNA is composed of 5' - CCGCGGCGG -3'. Which one of the following forms of nucleic acid structures will beadopted in water if sense and antisense strands are mixed in equal proportion followed by annealing?

QUESTION ID:53

Sometimes similar traits or characteristics evolve in ilwo distinct lineagesindependently, such as venoms in scorpions and snakes. This process can be described as:

QUESTION ID:54

Which one of the following floral homeotic genes is transcribed in all four whorls during flower development?

QUESTION ID:55

Which one of the following is NOT required in the blood glucose biosensor?

QUESTION ID:56

Which one of the following statements is NOT correct about collenchyma?

QUESTION ID:57

In a family, the father has an X-linked mutation causing a late-onset lethaldisorder and the mother is not a carrier. Based on the above information,which one of the following statements about the children the couple may have is correct?

QUESTION ID:58

Choose the INCORRECT statement

QUESTION ID:59

Aldosterone is synthesized exclusively in zona glomerulosa due to the  presence of ____ enzyme in addition to a dehydrogenase

QUESTION ID:60

Which cell cycle phase is typically the shortest in mammalian cells?

QUESTION ID:61

Which one of the following anthropogenic activities contributes the most nitrogen to the global nitrogen cycle?

QUESTION ID:62

Which one of the following options contains only those types of mapping populations that are characterized by 'true-breeding' individuals?

QUESTION ID:63

Which one of the following pairs of metabolic intermediates does NOT provide a backbone carbon skeleton for the synthesis of amino acids?

QUESTION ID:64

P-bodies are discrete cytoplasmic collections of RNAs and proteins that are involved in:

QUESTION ID:65

Which one of the following hormones has no supply store in the cells where it is synthesized?

QUESTION ID:66

Which one of the following combinations of excitation light and objectives gives the best lateral resolution in a fluorescence microscope?

QUESTION ID:67

In which of the following ecosystems would the largest percentage of Net Primary Productivity (NPP) be taken up by the grazing food chain?

QUESTION ID:68

How much hemoglobin is present approximately in each normal human red blood cell?

QUESTION ID:69

Which one of the following is true for Genome-wide association study (GWAS)?

QUESTION ID:70

The defect in a major semi-dwarfing gene of rice, sd-1 , leads to cultivar with short, thick culms and improved lodging resistance. The gene is related to which one of the following phytohormones?

QUESTION ID:71

Following statements were made about mRNA splicing:

A. Involvement of a cis-acting branchpoint site (or branchpoint sequence) present near 3' end of each exon is essential for splicing.

B. In the first step of splicing reaction, 2'-0H of the conserved U at the branch-site acts as a nucleophile to attack the plhosphoryl group of the conserved Gin the 5' splice site.

c. The newly liberated intron adapts shape ot a lariat due to joining ot the 5' end of the intron to the branch point

D. During the splicing process, there is no net gain in the number of chemical bonds

E. Prp22 (a DEAD-box helicase) is required for stripping the spliced mRNA from the spliceosome

Which one of the following options shows combination of all correct statements?

QUESTION ID:72

Shown below is the inversion product of the X chromosome of wild typeDrosophila. The w+ gene coding for the red eye colour is near the telomereand another gene roughest (rst+) is close tow+ butt towards thecentromere. The eyes of roughest mutants have rough appearance Theinversion brings w+ near the vicinity of highly compact centromericheterochromatin and places rst+ little farther away from the centromeric  heterochromatin
Which of the following phenotypes will NEVER be observed in the Drosophila strain with inversion?

QUESTION ID:73

Following statements were made about rolling circle mechanism of replication.
A It occurs unidirectionally, with only one replicating fo rk.
B. The E. coli Φ<t>X174 phage uses this mechanism tto replicate doublestranded circular genome.
C. E. coli utilizes this mechanism to replicate its double-stranded DNA genome.
D. In ɣ, the progeny DNA may range several genomes long before it is packaged.
E. The lagging strand is not formed in rolling circle mechanism of replication
Which one of the following options shows the combination of all correct statements?

QUESTION ID:74

Several extracellular mechanisms lead to intracellular changes to regulate stem cell behavior during development. Based on this, which one of the following statements is NOT true?

QUESTION ID:75

In yeast, temperature-sensitive mutants of cell cycle regulators, cdc2 (thekey cyclin- dependent kinase), cdc13 (required for telomeric DNAreplication), and cdc13 i'ad9 (that carries an additional mutation in the DNAdamage sensor) were isolated. When grown in non-permissivetemperature for a few hours, different phenotypes were observed in thesemutants. Choose the option that correctly describes the most likely phenotype for all of these mutants

QUESTION ID:76

A researcher had inoculated the bottom leaves of a wild-type tobacco plant with tobacco ringspot virus (TRSV) and made the fol lowing statements regarding the disease after 23 days post-inoculation
A. Strong ringspot symptoms develop on the lower leaves.
B. The ringspot symptoms are higher on the upper leaves.
C. The top leaves have no viral symptoms
D. The top leaves are immune to secondary infection by the same virus
Choose the option with all correct statements

QUESTION ID:77

Which one of the following phylogenetic trees correctly depicts the relationship between the given orders of pteridophytes, according to the Pteridophyte Phylogeny Group 1?

QUESTION ID:78

In a mammalian cell undergoing active glycolysis, what would be the effect of a sudden increase in the concentration of metabolites, AMP, citrate, ATP, and glucose-6-phosphate?
A. Increased ATP inhibits glycolysis.
B. Increased AMP stimulates glycolysis.
C. Increased citrate and glucose-6-phosphate stimulate glycolysis.
D. Increased AMP and citrate inhibits glycolysis.
Which one of the following represents the combination of all correct statements?

QUESTION ID:79

Apoptosis refers to programmed cell death that is triggered by specialized intracellular proteases called caspases. The intrinsic pathway of apoptosis
A. depends on the activation of Fas domain by the Fas ligand, which activates the DISC.
B. is regulated by the Bcl2 family of proteins.
C. consists of a key regulatory protein Apaf1 which is a water-soluble component or the electron transport chain.
D. recruits procaspase 9 into the apoptosome, and once activated, caspase 9 cleaves and activates downstream executioner caspases
Which of the following combinations represents all correct statements?

QUESTION ID:80

Phosphorus is an important essential element for living organisms. Given below are a few fluxes of the global phosphorus cycle.
A. Internal cycling in terrestrial ecosystems
B. Internal cycling in marine ecosystems
C. Terrestrial runoff into oceans
D. Natural chemical weathering in terrestrial ecosystems
Select the correct option that arranges the fluxes in an increasing order of magnitude

QUESTION ID:81

Stomata detached from the epidermis of common day flower (Commelinacommunis) were treated with saturating photon fluxes of red light. After a duration of 2 hours, the same stomata, under the background of red light were also illuminated with blue light. Which one of the following statements regarding opening of stomata! apertures is true?

QUESTION ID:82

In Bayesian statistics, A and ft: correspond to different hypotheses, H1 and H2, and D corresponds to the observed data (X)
An equation for hypothesis H1 can be given as P(H1 ID = 
Given below are statements related to the above equation
A. The equation represents the conditional probability of hypothesis H1, given the data.
B. The equation represents the probability of the data, given the hypothesis.
C. P(XIH1) is called a prior probability, which is assigned to the hypothesis before the data is observed or analysed.
D. P(XIH1) represents the likelihood under the hypothesis H1 

QUESTION ID:83

Certain statements are put forth on the regulation of renal blood flow and are given below.
A. Norepinephrine dilates the renal vessels.
B. Dopamine causes renal vasodilation and natriuresis.
C. Angiotensin II exerts a constrictor effect.
D. Prostaglandins decrease blood flow in the renal cortex and increase it in the medulla.
E. Acetylcholine produces renal vasodilation
Choose the option with the combination of all correct statements

QUESTION ID:84

Given below are certain statements regarding the light absorption by chlorophyll pigment molecule in a green leaf.
A. The absorption of a photon by a pigment molecule converts it from its lower state to an excited state.
B. Internal conversions or relaxations of pigments convert higher excited states to the lowest excited state, with a concern itant loss of energy as heat
C. The light reemitted from the lowest excited state of chlorophyll molecule is fluorescence.
D. Red light absorption by chlorophyll molecule results into higher excitation state relative to the blue light absorption.
Which one of the following combinations is correct?

QUESTION ID:85

Given below is the structure of a gene whose transcrription is terminated in a Rho-independent manner. When the terminator is operational, the short transcript of 150 bases is formed and when it is not operational, a longer transcript of 200 bases is formed. A researcher generated several mutations in the terminator region and examined the transcripts obtained
The manipulations done are:
A. Three nucleotides of the string of 8Ts were replaced by GCC.
B. The 8T sequence was transferred to the template strand.
C. The sequences that generate the paired stem were altered to disrupt pairing.
D. The sequences that generate the paired stem were altered to disrupt pairing, followed by introduction of compensatory mutations to restore
pairing
Choose the option that correctly predicts the potential transcript size in each of these cases

QUESTION ID:86

Mechanism of primary sex determination is best known in Drosophila and mammals. Given below are statements in regard of sex determination in these two model systems
A. In Drosophila, if sry gene product is present, it may block betacatenin signaling and along with SF1 , activate the sox9 gene.
B. In mammals, an alternate splicing of Sxl transcript that removes a stop codon and allows formation of a functional protein, is responsible for
initiating the female sex determination.
C. A trans-splicing event in Tra transcript results in formation of functional Tra protein in Drosophila.
D. XO individuals in Drosophila are males while, XXY individuals are females
Which of the above statements are correct?

QUESTION ID:87

Following statements were made about initiation of translation in eukaryotes
A. The elF2 facilitates correct recognition and binding of ribosomal subunits.
B. The elF2B activates elF2 by replacing its GDP with GTP
C. The elF3 binds to the 60S ribosomal subunit and inhibits its reassociation with the 40S subunit.
D.elF5 promotes association between the 60S ribosomal subunit and the 48S complex
E. The elF6 binds to the 60S ribosomal subunit and blocks reassociation with the 40S subunit.
Which one of the following options shows combination of all correct statements?

QUESTION ID:88

Given below are statements related to different types of natural selection models.
A. Directional selection changes the average value of a trait.
B. Stabilizing selection increases variation in a trait.
C. Disruptive selection reduces variation in a trait.
D. Balancing selection maintains variation in a trait.
Select the correct option that represents the combinations of statements that are NOT true about natural selection

QUESTION ID:89

The following proposed statements describe some aspects of thermoregulation
A The basal metabolic rate is rapidly adjusted in the thermoneutral zone to maintain temperature homeostasis.
B. The homeotherms who have the ability to hibernate, do not maintain normal physiological temperature range during hibernation.
c. The thermoregulatlon Is not regulated by hypothalamus.
D. Warm-blooded animals require more food compared to cold-blooded animals of the same size and weight
Which one of the following options represents combinations of all correct statements?

QUESTION ID:90

The following proposed statements describe some aspects of thermoregulation.
A The basal metabolic rate is rapidly adjusted in the thermoneutral zone to maintain temperature homeostasis.
B. The homeotherms who have the ability to hibernate, do not maintain normal physiological temperature range during hibernation.
c. The thermoregulatlon Is not regulated by hypothalamus.
D. Warm-blooded animals require more food compared to cold-blooded animals of the same size and weight

QUESTION ID:91

A transgenic line was developed in mustard. The TO transgenic line was selfed and the insertion of transgene was analyzed in the parental (P) and progeny lines (1 to 5). The T-DNA region (between left (LB) and right (RB) borders) used for transformation is outlined in Figure A. The pattern following Southern hybridization using probes A and B is represented in Figure B. Genomic DNA was digested with EcoRI (E). The thickness ofband indicates the intensity of hybridization
The following statements were made based on the above observation:
A. The developed transgenic line has a single copy of T-DNA.
B. The absence of band in progeny 4 is due to incomplete transfer of the
T-DNA during transformation.
c. Progeny 2 Is homozygous at the site of Insertion.
D. All selfed progeny of line 5 is expected to show hybridization with both probes A and B
Which one of the following options has all of the correct statements?

QUESTION ID:92

Given below are the list of plant hormones (Column X) and their biosynthesis precursors (Column Y)

Which one of the following options represents the correct match between column X and Y?

QUESTION ID:93

The cAMP-PKA-CREB pathway regulates many important biological processes, from hormone synthesis to inducing long-term memory in the brain. The following statements describe the effects of mutations in the components of the pathway on gene transcription by CREB
A. Loss of function mutation in a cAMP binding site of the PKA regulatory subunit leads to the inactivation of gene expression
B. Activating mutation in the GTP-binding domain of the a subunit of Gs leads to the activation of gene expression
C. Inactivating mutation that prevents the regulatory subunit of PKA to bind the catalytic subunit leads to the activation of gene expression.
D. Inactivating mutation in the PKA phosphorylation site of CREB leads to the activation of gene expression.
Which one of the following statements is INCORRECT?

QUESTION ID:94

The following represents a Southern hybridization of restricted genomic DNA, probed with a DNA fragment corresponding to gene 'Z'. 'Z' is a single copy gene. The hybridization patterns of parents and their progeny have been
presented
Which one of the following options is a correct interpretation of the observation?

QUESTION ID:95

Which one of the following nucleic acids with same concentrations in water, will form a stable stem-loop structure upon annealing by heating and flash cooling on ice?

QUESTION ID:96

Given below are species concepts (Column X) and their descriptions (Column Y):
Which one of the following options represents all the correct matches?

QUESTION ID:97

Based on theoretical concepts of mating systems in plants, pollen : ovule ratios are likely to be most skewed in which one of the following cases?

QUESTION ID:98

Given below are statements about the Kallmann syndrome.
A. It is a condition of hypogonadotropic hypogonadusm.
B. There is a loss of sense of smell in such individuals.
C. This syndrome is most common in women.
D. It happens due to mutation of the KALIG1 gene on X-chromosome thatcodes for an adhesion molecule necessary for the normal development of the gustatory nerve
Which one of the following options has the combination of all correct statements?

QUESTION ID:99

P aeruginosa makes a blue-green pigment called pyocyanin. To understand the pyocyanin biosynthetic pathway, mutants which cannot make pyocyanin were isolated. Six such mutants are crossed with eacother and the data is given below:
- is pyocyanin negative; + pyocyanin positiveBased on this data, can you predict how many genes are responsible for the pyocyanin production?

QUESTION ID:100

A portion of an mRNA encoding a protein is shown below, with the start
codon underlined. 5' ... CCUCAAACAGACACCAUGUUGCACCUGACUCCU ... 3' Which one of the following tRNAs is most likely used for translating the second codon in the open reading frame of the protein?
    

QUESTION ID:101

Photorespiration or C2 cycle takes place in three distinct organelles in the
plant cells. Following are certain statements related to the C2 cycle.
A Reduced ferredoxin and ATP are required for photorespiration and assimilation of resulting NH3.
B. Photosynthetic electron transport provides energy rich ATP and NAPDH for photorespiration.
C. Glutamate is translocated from chloroplast to peroxisome, while aketoglutarate is translocated from peroxisome to chloroplast.
D. The action of enzyme serine hydroxymethyl transferase takes place in peroxisome.
Which one of the following combinations has all correct statements?

QUESTION ID:102

Bacteria employ various mechanisms to invade or enter host cells, whichare either phagocytic or non-phagocytic in nature. Given below are some of the mechanisms which are generally used for carrying out this process
A. Some bacteria express a protein called invasin tlhat is recognized by host-cell ~ 1 integrins.
B. Actin polymerization along with assembly of clathrin coat results in the internalization of bacteria by zipper mechanism.
C. Some bacteria, including Salmonella enterica, use trigger mechanism to inject a set of effector molecules in the cytosol through type 111 secretion
system.
D. Some bacteria attach to host cell surface receptors inducing local elevation of Ca2+ in cell cytosol, leading to the fusion of lysosomes with
bacteria containing plasma membrane vesicles
Which one of the following represents the combination of correct mechanisms for invading non-phagocytic cells?

QUESTION ID:103

The following table lists habitat type (Column X) and geographic regions (Column Y) where they can be found:



Which of the following options represents the correct match between column X and Y?

QUESTION ID:104

Following are marker enzymes that would be used to identify correct subcellular fractions
Which one of the following options correctly pairs the enzymes with the subcellular fractions?

QUESTION ID:105

The following statements pertain to limb development in chick. Each statement describes an experiment and the expected outcome.
A. Targeted loss of retinoic acid synthesis in the forelimb causes a reduction of Tbx4 expression and the failure to form forelimbs.
B. When Fgf10 _secreting be?ds are placed at a somite level that induced limb bud expressing Tbx5 in the anterior and Tbx4 in the posterior part, a chimeric limb can be formed.
C. Constitutive activation of FGF receptors results in the loss of forelimb field, demonstrating that expression of Fgf8 functions to inhibit forelimb development
Which one of the following option(s) is/are correct?

QUESTION ID:106

An oligopeptide is subjected to amino acid analysis and found to have the following composition
Tyr, Phe, Asp, Val, Arg, Met
The following statements represents/outline/list the results obtained after analysis:
A. The above oligopeptide is subjected to N-terminal Edman degradation, revealing Tyrosine residue.
B. Trypsin treatment did not affect the peptide.
C. Cyanogen bromide treatment yielded a dipeptide, tetrapeptide, and free Arginine.
D. Chymotrypsin treatment yielded dipeptide and tetrapeptide. The composition of tetrapeptide was Valine, Arginine, and Methionine.
Based on above observations, what is the CORRECT sequence of heptapeptide?

QUESTION ID:107

Apoplast phloem loading is determined by the cellular location and transport function of the membrane-bound proteins. Following are certain statements regarding these proteins
A. SWEETs are the sugar transporter proteins and are capable of transporting only sucrose and not glucose.
B. Double mutants of Arabidopsis SWEET11 and SWEET12 results in carbohydrate accumulation in the source leaves and slower export of the
photoassimilates.
C. H+-symport mechanism loads sucrose or polyols into Sieve Element (SE)/Companion Cell (CC) complexes.
D. Several clades of sucrose/H+ symporters (SUTs. or SUCs) are localized to plasma membranes of minor vein SE/CCs and participate in apoplastic loading.
Which one of the following combinations is correct?

QUESTION ID:108

The statements below attempt to describe a few characteristics of Alu repeats found in the human genome
A. Alu elements are a class of short interspersed elements (SINEs)
B. SINEs are autonomous transposons
C. Alu repeat originated from cDNA copies of ?SL RNA
D. Alu repeats have a rela tively high AT content
E. They are preferentially located in the gene-poor G chromosome bands.
Which one of the following options shows combination of all correct statements?

QUESTION ID:109

Synchronous cultures of MCF7 breast cancer cells were grown and treated  with the following:
(i) buffer (plate was named MCF7),
(ii)_an inhibitor of Cyclin D (plate was
named MCF7.1), and
(iii) siRNA designed against Cyclin B1 (plate was named MCF7.
Following this, the cells were stained and sorted using flow cytometry. The relative amount of DNA in each of the three phases of the cell cycle (G1, S, G2/M in arbitrary units) were plotted against the number of cells, as
shown below.

Which one of the following options correctly represents all the cell cycle states of MCF7, MCF7.1 and MCF7.2?

QUESTION ID:110

A new strain of bacteria was created by introducing an artificial operon, to allow bacterial cells to grow in the presence of iron. The Fe++ operon consisted of genes that made the cells capable of tolerating increased iron. For efficient functioning of this operon, the following desirable features were considered.
Which one of the following can be used to develop this operon?

QUESTION ID:111

Which one of the following Newick trees represents the correct relationship between apes.

QUESTION ID:112

The structure and process of formation of different antigens in blood ABO system are given in the following statements:
A. Galactose is added to the terminal of H-antigen lby a transferase expressed in individuals with type A blood.
B. The B antigen is formed by a transferase expressed in individuals with type B blood which adds a terminal N-acetylgalactosamine to H-antigen.
c. The H-antigen is formed by fucose transrerase that adds a terminal fucose to its precursor.
D. The H-antigen is the precursor of both the A- and B- antigens and it is the blood group antigen in persons of type O blood.
Which one of the following options represents the correct combination of statements?

QUESTION ID:113

The following statements are suggested regarding the principle and uses of positron emission tomography (PET):
A The PET scanner is a positron ray detector.
B. The PET scanner cannot determine the location of collision between positron and electron in the brain.
C. The typical PET aciivation studies can measure the absolute metabolic activity of brain.
D. In PET, a radioactive isotope is introduced into blood as 'tracer' that rapidly decays by emitting a positron from their atomic nuclei.
Which one of the following options represents the combination of correct statement(s)?

QUESTION ID:114

In a study comparing different plant communities (A to D) across a landscape, the following data were obtained:
Which one of the following options represents the pair of communities with highest similarity value when Sorenson's coefficient is used?

QUESTION ID:115

The table below lists phylogenetic reconstruction methods and the description of these methods, which includes both algorithmic and optimality-based methods or criteria\

Select the option that best matches the tree reconstruction method (Column X) with its correct description in Column Y

QUESTION ID:116

The table below represents some protein modifications in Column X and their functions in Column Y

Which one of the following options represents all correct matches between Column X and Column Y?

QUESTION ID:117

The central rod domain of keratin protein is 300 amino acids in length. What is the approximate length (in A) of the rod domain if the peptide consists of
i) distorted a-helix
ii) true a-helix
iii) anti-parallel j3-sheet

QUESTION ID:118

In an experiment using nude mice, the population is divided into two groups, A and B. Group A mice are injected with T cells from normal mice and Group B mice are left untreated. Both the groups are then immunized with LPS. Which one of the following statements regarding antibody production in groups A and B is most likely to be true?

QUESTION ID:119

In birds and mammals, 3rd, 4th and 6th aortic arches persist in adult animals with some structural modifications. Which of the following modified organization is correct?

QUESTION ID:120

Unknown antigens can be detected or measured by a sandwich ELISA whereas Elispot assays measure the number of cells capable of secreting particular molecules such as cytokines which is considered as antigens.
Which of the following is true for both assays?

QUESTION ID:121

Iron (Fe) is taken up by cells via receptor-mediated endocytosis utilizing transferrin and transferrin receptor. In a cell line with a mutation in the transferrin receptor that is unable to interact with transferrin at pH (4-6),
which one of the following steps will be first affected in this pathway?

QUESTION ID:122

Consider a highly diverse community of closely related species of lizards which has evolved in a short period of time and that occupies different ecological niches in peninsular India. What type of speciation process can
explain the above pattern?

QUESTION ID:123

Defending a territory is energetically expensive and animals should invest in this only if it is profitable A sunbird species is dependent on a plant species that contains nectar-rich flowers, making it an important resource for the sunbird. Males may defend territories containing these plants against other males, while allowing females to access the flowers. In this way they keep competitors out and get access to the females.
The columns below (P to S) represent characteristics of the resources and their variants (i and ii)

From the given options, choose the combination of plant characteristics that makes defending a territory most profitable for males

QUESTION ID:124

Extracellular matrix comprises of various proteins and polysaccharides that assemble into an organized meshwork. This associates with the cells that produce them. Given below are a few statements regarding different components of the matrix.
A. Collagen is the major protein of the extracellular matrix and is a long, and triple-stranded helical structure.
B. Hyaluronan which is produced in large quantities during wound healing is a type of gIycosaminogIycan (GAG) that contains sulfated sugar and is covalently linked to the core protein.
C. Syndecans are plasma membrane proteoglycans that interact with the actin cytoskeleton and signaling molecules of the cell cortex.
D. Decorin is a small
Which one of the following options represents INCORRECT statement/s?

QUESTION ID:125

The characteristic features and causes of different heart sounds during a cardiac cycle of humans are given in the following statements
A. The second heart sound is loud and sharp when the diastolic pressure is decreased in the aorta or pulmonary artery.
B. Sudden closure of atrioventricular (AV) valves at the start of ventricular systole caused vibration that produces first heart sound.
c. The second heart sound is caused by the vibration associated with the closure of aortic and pulmonary valves after the end of ventricular systole.
D. The first heart sound is soft when heart rate is low as the ventricles are well filled with blood and the leaflets of AV valves float together before systole.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:126

Selected human diseases and their vectors are listed below:

Which one of the following options represents the correct match between column X and column Y?

QUESTION ID:127

You have purified an enzyme that has a molecular weight of 60 kDa. You run this protein on an SOS-PAGE gel and get the following results
Which of the following statements is valid for the quaternary structure of this enzyme?

QUESTION ID:128

Figure A represents the sites for Ncol (N) in a binary vector pCSIR2023. The vector is 16500 bp in size. Figure B represents the fragments observed when the vector is either digested with Ncol (N) or double digested with Hindlll and Ncol (H+N). The intensity of fluorescence of the 453 bp fragment is double that of the 516 bp fragment
Which one of the following statements regarding the numbers and location(s) of Hindlll site is correct?

QUESTION ID:129

Which one of the following statements about change in temperature with elevation is correct?

QUESTION ID:130

The sensory nerve fibers (Column X) and the sensory receptors connected to different sensory nerves (Column Y) are given below

Which of the following options represents the correct match between column X and column Y?

QUESTION ID:131

In DNA foot-printing,
A The DNA is labelled by random priming so that the entire DNA is labelled and one does not miss out any region that binds with the given protein.
B. The DNA is end-labelled so that the bands get organized from higher to lower size after electrophoresis and autoradiography.
C. A sequencing polyacrylamide gel is used to resolve all the fragments distinctly.
D. A higher concentra1ion of agarose gel is used to resolve the finer bands.
Which one of the following options has the combination of all correct statements?

QUESTION ID:132

Given below are statements about development in d ifferent model organisms
A. Xenopus egg has yolk and hence undergoes meroblastic cleavage.
B. Embryonically transcribed beta-catenin in the blastomeres of sea urchin embryos regulates the autonomous specification of micromeres.
C. The sodium pump activity in the trophoblast helps in the formation of blastocoel of a mammalian blastocyst.
D. Prevention of tubal pregnancy is one of the major functions of zona pellucida in humans.
Which combination of the statements is true?

QUESTION ID:133

Epistasis is observed between different genes in flower color of sweet pea. A red variety on selfing yields red:white in ratio 9:7. The precursors and intermediates give white color. The following biochemical pathways were
proposed for the above observations:
Which one of the options represents the correct pathway(s) that explains the observations?

QUESTION ID:134

Match the names of scientists (column X) with the ecosystem concepts (column Y) they are known for:

QUESTION ID:135

In C. elegans, PAR proteins segregate at the cell cortex in the zygote to establish cell polarity. This is dependent on the regulation of the cortical actin cytoskeleton by RhoA. An investigator sought to directly inhibit actin polymerization to analyze the impact of this inhibition on PAR protein localization. Which one of the following chemicals would be the most suitable

QUESTION ID:136

This is a hypothetical example. In a plant, a single gene governs flower color. The wild type color is red, while the mutant is white. It was demonstrated that insertion of a transposable element caused the white phenotype. In a PCR test, a set of primers outside the site of insertion is used to amplify the genomic DNA and the PCR products are resolved by Agarose gel electrophoresis. A geneticist made a cross between two plants. 30 progeny from the cross was analyzed by PCR. Each lane in the gel below represents analysis of one progeny
Based on the above, which one of the following statements is correct?

QUESTION ID:137

The amino acid sequence of tetrapeptides (P, Q, R) is shown below.
P) Asp-Gly-Asp-Ser Q) Gly-Ser-Arg-Gly R) Gly-Lys-Arg-Ala
i. Calculate the net charge on the above tetrapeptides at pH 7.0
ii. If the mixture of the above tetrapeptides is separated on a cationexchange
column at pH 7.0, which tetrapeptide will elute last?
Choose the correct answer given below.

QUESTION ID:138

The figure below depicts the reflectance curves of different features found in an urban ecosyste
Which one of the options below correctly identifies the reflectance curves?

QUESTION ID:139

What is the V0!Vmax ratio for an enzymatic reaction when [SJ= 3 Km and 9 Km, respectively?

QUESTION ID:140

By expressing the EGF-like ligand LIN-3, the c. e/egans anchor cell (AC) directly triggers vulval development. LIN-3 acts at a distance and has a graded action. The levels of LIN-3 can be controlled by using various
genetic techniques.

Which one of the following options is a correct match between column I and column II?

QUESTION ID:141

The following statements describe the developmental processes during different modes of reproduction in angiosperms:
A. In double fertilization, one sperm fuses with the egg and other with the central cell to form the zygote and endosperm, respectively.
B. In sporophytic apomixis, a diploid cell gives rise to the next generation thereby maintaining the maternal genotype.
c. In gametophytic apomixis, a reduced egg cell forms apomictic embryo through parthenogenesis.
D. In pseudogamy, the functional endosperm is formed without fertilization

QUESTION ID:142

Researcher plans to study protein trafficking into the endoplasmic reticulum (ER). For this purpose, they plan different experimental conditions shown below:
A. The cytosol is mixed with mRNA that codes for a secreted protein, followed by wesiern blotting with antibodies against secreted protein.
B. The cytosol is mixed with mRNA that codes for a secreted protein and rough microsomes, followed by western blotting with antibodies against secreted protein.
C. The cytosol is mixed with mRNA that codes for a secreted protein and rough microsomes followed by protease treatment. Subsequently, western blotting with antibodies against secreted protein is done
Consider that mRNA that codes for a secreted protein is added in abundant amount, which experimental control/s would be the best to confirm the polypeptide entry into the ER?

QUESTION ID:143

A mutant strain of E.coli having defects in one of the DNA repair pathways was identified. To identify the pathways where mutation occurred, aresearcher looks at the following parameters and identified the defect to be
in base excision repair pathway
A. Topoisomerase 11 enzyme activity
B. AP endonuclease activity
c. Expression ot mutL and muts
D. DNA glycosylase activity
E. DNA ligase activity
Based on the changes in which of the above parameters, this conclusion can be drawn?

QUESTION ID:144

The graph given below is based on the optimal foraging theory. If the Y axis represents "Cumulative Resource Intake" following tihe law of diminishing
returns, what do T and T' stand for?

QUESTION ID:145

The graph below depicts the net change in forest cover in four regions (AD) between 1990 and 2020, according to the FAO report - 'The State of World's Forests 2020'.
Which one of the following options correctly identifies these regions?

QUESTION ID:146

The Cre-LoxP system was used to knock-out the p53 gene from the mice lungs. An immunoblot analysis was carried out as shown below

The following assumptions were made
A. The LoxP system did not work since the recombinase was not functional.
B. The Lox P sites were introduced under a promoter specific for lungs.
C. The tissue-specified promoter selected was of the prostate gland.
D. The mice died because of being knocked out of p53.
E. The knocked-out mice developed mutagen-induced tumours in their prostate gland more rapidly than in their lungs
Which one of the following is correct combination of above assumption?