Previous Year Questions

Performance Meter

0%

TLS Online TPP Program

QUESTION ID:1

The figure summarizes the observation following a cross between two haploid strains of Neurospora crassa having alleles A and a, respectively.

 

The following statements were made:

A. In 'I', segregation of alleles occurred in Anaphase II.

B. Crossing over between the centromere and the gene occurred in 20% of the meiocytes.

C. With reference to the two non-recombinant parental chromosomes, there are 6 different ways by which they can orient themselves at the equatorial plate.

D. The gene is 20cM away from the centromere.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:2

Certain statements are made below about hemoglobin.
A. HbA1c has glucose attached to the terminal valine i n each β chain.
B. NADH-methemoglobin reductase system in RBC converts methemoglobin to hemoglobin.
C. 02 binds to the Fe2+ in the heme moiety of hemoglobin to form oxyhemoglobin.
D. The affinity of hemoglobin for 02 is much higher than that of its affinity for carbon monoxide.

Which one of the following options represents combination of all correct statements?

QUESTION ID:3

Different leads used in electrocardiography (Column X) and the electrode placement and connections (Column Y) are listed below: 

Column X

Column Y

ECG leads

Electrode placement and connections

a. Standard limb lead I

i

Left leg - positive

Right arm - negative

b. Standard limb lead II

ii

Left leg- positive

Left arm- negative

c. Standard limb lead III

iii

Right arm- positive,

Left arm and left leg connected together- negative

d. Augmented limb lead aVR

iv

Left arm - positive

Right arm - negative

Which one of the following options represents the correct match between Column X and Column Y?

QUESTION ID:4

The following tree shows phylogenetic relationships between species A to D

Which of the following molecular mechanisms would be responsible for the phylogenetic relationships shown between species A to D?

QUESTION ID:5

Single-stranded DNA binding properties of three DNA repair proteins (A, B, and C) were investigated. A biotinylated single-stranded DNA was prepared and incubated with the proteins in different combinations as shown below. This was followed by streptavidin pull-down to enrich ssDNA-bound proteins, which were detected by western blot analyses using specific antibodies.
Which one of the following statements is NOT a correct conclusion from the above study?

QUESTION ID:6

Given below is the list of F-box proteins of the SCF ubiquitin E3 ligase complex (Column X) and their associated regulatory proteins of phytohormone pathways (Column Y).

Column X

Column Y

A. TIR1

i.

Degradation of JAZ repressor protein

B. COI1

ii.

Targets the transcription activator EIN3 for degradation

C. SLY1

iii.

Degradation of AUX/IAA repressor protein

D. EBF1

iv.

Degradation of GID1-bound DELLA repressor

Which of the following combinations represents the correct match between Column X and Column Y?

QUESTION ID:7

Stable coexistence is possible in a classical two-species Lotka-Volterra competition model when

QUESTION ID:8

Following statements have been made about vaccines.
A. Covaxin is a killed cell vaccine and Corbevax is a subunit vaccine.
B. Oral polio vaccine is given as a live attenuated vaccine to adults and as a killed vaccine to children.
C. Third generation vaccines against smallpox are based on attenuated Vaccinia virus.
D. MMR vaccine is given to children to protect them against diphtheria.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:9

The following experimental manipulations were carried out with Xenopus embryo.
Manipulation X: Exposure to ultra violet radiation leading to the failure of cortical rotation.
Manipulation Y: Gastrulae treated with lithium chloride, an agonist of canonical Wnt signaling.
The following statements were made with respect to the above manipulations and genes involved in setting up dorso-ventral polarity in amphibians.
A The phenotype obtained due to manipulation X can be rescued by injection of noggin in 1-cell embryo
B. Chordin mRNA will be enriched in embryos of manipulation X as compared to those of manipulation Y
C. Injection of cDNA for chordin into ventral blastomeres leads to the induction of a secondary axis.
D. Experimentally depleting 13-catenin transcripts in 1-cell embryo by antisense oligonucleotides leads to phenotype similar to that obtained from manipulation X.

Which one of the following options represents all correct statements?

QUESTION ID:10

To test the lever-arm model of myosin movement, an investigator utilizes recombinant DNA technology to attach myosin head to various length of neck domains. In the schematics shown below (1-4 ), the y-axis represents the velocity of myosin in μm/sec on the actin filament, and the x-axis shows the recombinant myosins (a-d; shown on the left) that were utilized to calculate the velocity. Considering that all the appropriate conditions were applied to estimate the velocity of recombinant myosin, choose the graph that correctly represents the velocity of recombinant myosin.

QUESTION ID:11

DELLA proteins are known to interact with phytochrome interacting factors (PIFs) and regulate genes involved in etiolation in Arabidopsis. Following are certain statements regarding the function of DELLAs under dark and light conditions:
A. In dark, high level of gibberellic acid (GA) helps DELLAs to directly bind to PIFs.
B. During light, the level of GA goes down and helps DELLA-PIF complex to bind to the promoters of the etiolation responsive genes.
C. Binding of DELLA proteins to PIFs prevents the transcription of PIFinduced genes, leading to photomorphogenesis.
D. Skotomorphogenesis is due to the degradation of DELLA proteins and binding of the PIFs to the etiolation responsive genes.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:12

Given below is a PONDR (Predictor of Natural Disordered Regions) score-plot versus the protein sequence.

Based on the above figure, which one of the following statements is correct?

QUESTION ID:13

The glomerular ultrafiltration coefficient (Kf) can be changed by the mesangial cells producing a decrease in Kf largely due to a reduction in the area available for filtration. The following statements are made about some agents that affect the mesangial cells.
A. Norepinephrine causes contraction of mesangial cells.
B. Angiotensin II causes relaxation of mesangial cells.
C. Histamine causes relaxation of mesangial cells.
D. Atrial natriuretic factor (ANF) causes relaxation of mesangial cells.

Which one of the following options represents combination of all correct statements?

QUESTION ID:14

The following graphs represent the effect of two environmental conditions (E1 and E2) resulting in two optimal phenotypes (OE1 and OE2) for their respective environmental conditions. 

Which one of the options represents phenotypic plasticity? 

QUESTION ID:15

Results of immunoprecipitation (IP) of HA-Yfg are shown below .

 

Given below are options of controls that could be used to confirm that F1β actually associates with HA-Yfg.

A. Include a lane where α-HA is not added but Protein A-Sepharose is added

B. Include a lane where neither α-HA nor Protein A-Sepharose are added

C. Include a lane where α-HA is added but Protein A-Sepharose is not added

D. Include a lane where α-Myc is added instead of α-HA before addition of Protein A-Sepharose.

Which one of the following options represent(s) the most appropriate control(s)?

QUESTION ID:16

A decapeptide composed of MFTGPYCPRW was dissolved in 20 mM HEPES (pH 7.0), 50 mM NaCl, 50 mM Na2S04, 5 mM OTT, and 4 mM EDTA. Which one of the following statements about the peptide in the given buffer conditions is correct?

QUESTION ID:17

The following statements summarize metamorphosis and regeneration.
A. Many changes during amphibian metamorphosis are regionally specific. Although the tail epidermis never dies, the head epidermis does.
B. In neoteny, the juvenile form is slowed down, while the gonads and germ cells mature at their normal rate.
C. In epimorphosis, tissues never dedifferentiate into a blastema, divide, or re-differentiate into the new structure.
D. In the regenerating salamander limb, the epidermis forms an apical ectodermal cap. The cells beneath it dedifferentiates to form a blastema.
E. In hydras, there appear to be head activation gradients, head inhibition gradients, foot activation gradients, and foot inhibition gradients.

Which one of the following options has the correct combination of statements that will lead to normal developmental outcome in organisms?

QUESTION ID:18

Protein phosphatase 2A (PP2A) is a critical regulator of Cdk1 substrates during the cell cycle. The B55 subunit of PP2A influences the substrate selectivity, localization, and regulation of the enzyme. Given below are a few statements about PP2A and its regulation during the M-phase of the cell cycle.
A. PP2A-B55 activity is high during interphase but inhibited during early mitosis when M-Cdk activity rises.
B. M-Cdk1 turns off PP2A-B55 via the phosphorylation of an intermediary protein kinase called Greatwall.
C. M-Cdk1 turns on PP2A-B55 via the phosphorylation of an intermediary protein kinase called Greatwall.
D. When anaphase is initiated and M-Cdk1 activity declines, PP2A-B55 promotes dephosphorylation of Cdk1 substrates

Which one of the following combinations represents all the correct statements?

QUESTION ID:19

Following are a few statements made regarding the lac operon.
A. The LacZ, LacY and LacA are encoded by a single transcript.
B. The three proteins are translated as a single precursor and then processed.
C. In the presence of glucose, lactose can upregulate the operon.
D. lsopropyl thio β-D-galactoside (IPTG) is a gratuitous inducer.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:20

Following are the different critical reaction steps involved in the oxidation of lipids in many organisms.
A. Reaction of fatty acyl-CoA with carnitine
B. Thiolysis
C. Hydrolysis of triacylglycerol by lipase
D. Activation of fatty acid by conjugating to CoA
E. Hydration

Choose the correct sequence of reaction steps in ascending order.

QUESTION ID:21

A cancer cell line obtained from a rat glioma tumour was stained with the nuclear dye Hoechst 33342 and sorted using FAGS. About 0.4% of the population stained lightly (LSP), distinct from the densely stained population of cells (DSP). Equal number of cells from these two populations were subcutaneously implanted into a suitable animal model to develop tumours. Following statements are made from this experiment:
A. The LSP cells will give rise to tumours.
B. The DSP cells will give rise to tumours.
C. The LSP cells can give rise to LSP and DSP cells.
D. The DSP cells can give rise to LSP and DSP cells.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:22

Changes in plasma osmolarity and extracellular fluid (ECF) volume affect thirst by separate pathways as given in the following statements.
A. Hypertonicity leads to osmoreceptor activation giving rise to hypothalamic control of thirst.
B. Hypertonicity leads to baroreceptor activation giving rise to hypothalamic control of thirst.
C. Hypovolemia leads to activation of baroreceptor and angiotensin II giving rise to hypothalamic control of thirst.
D. Hypovolemia leads to osmoreceptor activation giving rise to hypothalamic control of thirst.

Which one of the following options represents combination of all correct statements?

QUESTION ID:23

Five different strains of Salmonella (1, 2, 3, 4, 5) which can utilize lactose (Lac+ ) as the sole carbon source but cannot synthesize arginine (Arg-) are mixed with five other strains (6,7,8,9,10) that cannot utilize lactose (Lac-) and can make arginine (Arg+). These strains are mixed in all possible combinations and plated on appropriate plates to get Lac+ Arg+ recombinants. The following results were obtained, where H represents 'high numbers of recombinants', L refers to 'low numbers of recombinants' and O represents 'no recombinants'.

On the basis of these results, the sex type (either Hfr, f + or F-) to each of these

strains was assigned .

A. Strains 2,3,6,7 are F-

B. Strains 2,3,5,6,7,9 are F-

C. Strains 1,4,8,10 are F +

D. Strains 1,4,8,10 are Hfr

Which one of the following options represents a combination of all correct statements?

QUESTION ID:24

The following statements are made about how CD4 T cells provide help to CD8 T cells.
A. Antigen/MHC-11 complexes on CD4 T cells interact with antigen/MHC-1 complexes on CD8 cells.
B. A single dendritic cell (DC) presents antigen on MHC-1 and MHC-11 at the same time.
C. CD4 T cells activate DCs which produce chemokines like CCL3 and CCL4 that can specifically attract CD8 T cells to form a CD4-CD8-DC triad.
D. CD4 T cells help B cells, which differentiate into plasma cells and secrete antibodies that form immune complexes which bind to FcyRs on CD8 T cells.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:25

Eukaryotic transcription factors TF1 and TF2 bind to independent cis regulatory elements (Cis1 and Cis2, respectively) upstream of TATA box and positively regulate gene expression. Histone modifier 1 (HM1) binds to TF1 but not to TF2. In order to determine how genes are regulated by these three factors, an in vitro transcription and translation assay was set up. A packaged DNA containing region from Cis1 to Cis2, along with eukaryotic minimal promoter fused upstream of a luciferase gene, was purified. The luciferase activity, upon addition of a combination of TF1, TF2 and/or HM1, in presence ofr RNA polymerase and translation mix is plotted below .

 Which one of the following models best represents the results above? 

QUESTION ID:26

Asynchronous cultures of E. coli were grown in 14N and then shifted to 15N medium containing a chemical C (0 minute) and incubated for two generation times (i.e. 40 minutes). Proportion of hybrid DNA ( 14N-15N) was measured at various time-points and results are depicted in the following table. 

From the data, it was concluded that the chemical C inhibits DNA replication.

Which one of the following possibilities could be the likely mode of action of chemical C?

QUESTION ID:27

Fgf8 expression in the anterior developing mouse brain induces anterior identity marker expression (anteriorization). The Fgf8 receptor is uniformly expressed in the brain. Which one of the following experiments best demonstrates this fact?

QUESTION ID:28

Salicylic acid (SA) regulates hypersensitive response and effector-triggered immunity at the primary infection site and systemic acquired resistance (SAR) in the distal tissues of the plants. Which one of the following statements regarding the functionality of the Non-expressor of PR genes 1 (NPR 1) in the distal tissue is correct?

QUESTION ID:29

A uniformly labelled (32P) single-stranded DNA (ssDNA) was incubated with a homologous double-stranded DNA (dsDNA) in the presence of Rad51 and/or RPA along with ATP or the non-hydrolysable ATPγS to study a three-strand exchange reaction. The reactions were terminated at various time points, DNA were digested with EcoR/ followed by

Based on the above data, which one of the following statements is INCORRECT?

QUESTION ID:30

A cross was made between wild type female Drosophila melanogaster and mutant males which are yellow bodied (y) and crossveinless (cv). The two genes are present on the X-chromosome. The F1 progeny was sib-mated and the observation of F2 progeny is tabulated below.

Phenotype

No. of male progeny

No. of female progeny

wild type

45

100

yellow body and crossveinless

40

0

yellow body

6

0

crossveinless

9

0

Total no. of progeny analyzed = 200

With regard to the above analysis, which one of the following statements is correct?

QUESTION ID:31

The following statements describe possible nomenclature rules for plants and animals.
A. A plant and an animal cannot bear the same binomial latin name.
B. The valid name of a tax on is the oldest available name that has been applied to it and which is validly published.
C. A species may not be removed from a genus once described.
D. Only a single specimen 'holotype' acts as the primary "name bearer" for any species.

Select the option that contains all accepted statements about nomenclature rules.

QUESTION ID:32

In a plant species, the following pathways contribute to seed color. The wild type phenotype of seed color is red. 

• A recessive mutation of gene A leads to white color pigment.

• A recessive mutation of gene B leads to a transparent outer layer and the color of the seed is based on the color of the endosperm.

• The two genes are present on two different chromosomes.

• Often, a yellow or white colored seed has red spots.


Based on the above information, the following statements were made:

A. The probability of getting red colored seeds from a dihybrid cross involving two heterozygous mutants is 9/16.

B. The mutation in gene B could have been caused by a transposable element.

C. A plant producing red seeds would breed true for the seed color.


Which one of the following options represents a combination of all correct statements?

QUESTION ID:33

The exponential growth equation dN/dt expresses the rate of population growth as the per capita rate of increase, r times population size N. This exponential model of population growth can be modified to produce a model in which population growth is sigmoidal by adding an element that slows growth, as population size approaches carrying capacity, K. If the per capita rate of increase rmax is the maximum per capita rate of increase, then select the correct option for the logistic equation for population growth. 

QUESTION ID:34

The steady state level of a plant metabolite 'M' is determined by the complex interplay of its biosynthesis, catabolism and transport processes from the source to the sink organ. A researcher tested following molecular and genetic strategies for engineering the metabolite 'M' in the native host plant.
A. Increasing catalytic efficiency of its rate-limiting biosynthetic enzyme in the source organ .
B. Increasing catalytic efficiency of the catabolic enzymes in the source organ.
C. Generating knock-out of the transporter protein in the source organ.
D. Repression of the catabolic enzymes in the sink organ.

Which of the above-mentioned strategies will provide a higher accumulation of the target metabolite 'M' in the sink organ?

QUESTION ID:35

The lines (A to D) in the graphs represent trait relationships that capture the allocations of different tree species to their present reproduction versus present growth, and their offspring number versus offspring size.

An isolated patch of forest land with nutrient-rich soils was recently cleared for timber. Which one of the options represents the correct combination of trait relationships that are most likely in the tree species that will invade and thrive in the early stages of secondary succession?

QUESTION ID:36

The feedback control of the branched amino acid biosynthesis pathway in Arabidopsis is given below. The activity of Acetohydroxyacid Synthase (AHAS) enzyme is feedback inhibited by Leucine and Valine synergistically, whereas lsopropyl malate synthase (IPMS) enzyme activity is inhibited by Leucine only. Feedback resistant mutant lines of AHAS and /PMS genes are ahas2-1D and ipmst-1D, respectively.

 

The phenotype of these feedback resistant mutants was analyzed by growing them in the following Murashige and Skoog (MS) medium combinations.

A. MS medium only

B. MS medium supplemented with Leu only

C. MS medium supplemented with Val + Leu

D. MS medium supplemented with Val only


Which one of the following statements is correct?

QUESTION ID:37

A DNA sequence is given below:
5' -A TGACGA TGACGAGACGATGCAGATGA T AGCAGT AGCGAA TGAC -3'
The following primers were designed to amplify the above sequence:

A. 5' -T ACTGCT -3'
B. 5' -CAGTAAG -3'
C. 5' -ATGACGA-3'
D. 5' - GTCATTC - 3'
E. 5' -TCGTCAT -3'
F. 5' - GAATGAC-3'
If we negate the effects of primer length, Tm, %GC and other factors,

which one of the following options represents a combination of primers that could amplify the above DNA sequence?

QUESTION ID:38

Given below is a list of regulatory RNAs (Column X) and their modes of action (Column Y).

Column X

Column Y

Regulatory RNA

Mechanism for the control of gene expression

A. Riboswitch

i.

Base-pairing with specific mRNAs and controlling their stability and their translation.

B. MicroRNA (miRNA)

ii.

Change their conformation when bound to small molecules, usually metabolites.

C. Small interfering RNAs (siRNAs)

iii.

Complementary base pairing followed by RISC-mediated mRNA cleavage.

Which one of the following options represents all correct matches between Column X and Column Y?