Previous Year Questions

Performance Meter

0%

TLS Online TPP Program

QUESTION ID:1

A chess board contains 64 squares of 5 cm size, in 8 rows and 8 columns, alternately black and white. What is the total length of edges (in m) between the squares in the chessboard?

QUESTION ID:2

Two rings made of metals A and B with ring A having a larger diameter, are placed concentrically leaving an annular gap. The thermal expansion coefficients of the two metals are CA and CB . Identify the correct statement(s) from the following.
A. The gap will decrease if CA < CB .
B. The gap will remain the same if CA = CB .
C. The gap will increase if CA < CB.

QUESTION ID:3

A car is moving along a bend in a road. The bend forms a large quarter circle. If the distance between the left and right wheels of the car is 2 m, then the difference between the distances travelled by the inner wheels and the outer wheels (in m) as it traverses the bend is

QUESTION ID:4

Human females have two X chromosomes, each of which can be passed on to their son or daughter with equal probability. Human males have one X chromosome which is passed on to their daughters and one Y chromosome which is passed on to their sons. Assuming equal numbers of males and females in a population, if an X chromosome is randomly sampled from the population, what is the probability that it was inherited from a female of the previous generation?

QUESTION ID:5

The graph shows the distribution of lifespan (in years) for individuals from species 1 and species 2.
Ifμ and σ represent mean and standard deviation of the lifespan, respectively, then, which of the following statements is true?

QUESTION ID:6

The following graph shows the mortality risk of a disease with respect to parameters A and B.
Which of the following combinations of parameters is associated with the lowest mortality risk?

QUESTION ID:7

How many integers can divide 1184 leaving a remainder of 29?

QUESTION ID:8

The speed of a car travelling with variable acceleration along a straight line is shown in the figure.
If a1 , a2 , a3 are the accelerations at times t1 , t2 , t3 , respectively, then

QUESTION ID:9

The cost of 2 mangoes, 1 coconut and 2 bananas is Rs 71, while the cost of 5 mangoes, 3 coconuts and 4 bananas is Rs 182. What is the cost of 1 mango and 1 coconut?

QUESTION ID:10

The largest integer between 1 and 105 when written in words that does not contain the letter 'N' or 'n' in its name is

QUESTION ID:11

In a class, boys secure 69% marks on the average while girls secure 72% marks on the average. If the average marks of the entire class is 70% which of the following statements is valid?

QUESTION ID:12

A ball of moulding clay, whose radius is a, is remoulded into a cube. What is the approximate length of the side of the largest cube that can be so made?

QUESTION ID:13

The following spider diagram shows the marks obtained (out of 10) by three students in five tests.
Which one of the following is INCORRECT?

QUESTION ID:14

The difference between a three-digit number (with non-repeating digits) and the same number in the reverse order is always divisible by

QUESTION ID:15

If Pencils are Erasers, some Erasers are Sharpeners, some Erasers are Crayons, no Crayons are Sharpeners but some Crayons are Pencils then in the given Venn diagram, which of the following is represented by the shaded area?

QUESTION ID:16

A pen, pencil and an eraser together cost Rs. 21. The pen costs as much more than the pencil as the pencil does than the eraser. How much does the pencil cost?

QUESTION ID:17

A cardboard sheet of size 60 cm x 60 cm is used to make hollow cubes having sides of 5 cm. What is the maximum number of cubes that can be made?

QUESTION ID:18

If liars always lie and truthful persons never, and in a group of 10 persons everyone calls all others liars, then the number of liars among the 10 is

QUESTION ID:19

Three comparable brands of 1 litre cans of a liquid detergent are available in a shop with different offers as shown in the table.
If 4 litres of detergent is to be purchased, then the best choice (based on unit price) would be

QUESTION ID:20

In a family of two males and three females, A is the daughter of B and sister of C. Eis the spouse of 8 and mother of D. C is not the brother of D. Which of the following statements is NOT correct?

QUESTION ID:21

Which of the following biogeographic realms are divided by the Wallace Line?

QUESTION ID:22

Loss of function mutations in snapdragon (Antirrhinum) genes CYCLOIDEA (CYC) and DICHOTOMA (D/CH) will result in the

QUESTION ID:23

Which one of the following hormones is NOT exclusively synthesized from a single location in the body?

QUESTION ID:24

The trp operon can be induced by the addition of indole propionic acid (IPA), which binds to the trp repressor but does not allow the change in conformation. Upon the addition of IPA, what will be the order of the translation of the enzymes encoded by the operon?

QUESTION ID:25

In which one the following, the proton motive force generated in mitochondrial electron transport is NOT used?

QUESTION ID:26

Which one of the following compounds can serve as a direct acceptor of an additional amino group derived from amino acid catabolism?

QUESTION ID:27

Which one of the following statements best describes an acrosomal reaction?

QUESTION ID:28

Which one of the following is NOT an example of programmed cell death in plants?

QUESTION ID:29

The immune recognition of "self-molecules" is important for which of the following events?

QUESTION ID:30

The Ti plasmid from Agrobacterium tumefaciens has genes for auxin, cytokinin and opine synthesis while genes for opine catabolism and Vir genes lie outside the T-DNA region. Which one of the following genes are involved in providing carbon source to Agrobacterium in their ecological niche?

QUESTION ID:31

Among the organelles listed below, which one does NOT obtain proteins via vesicular transport?

QUESTION ID:32

Which one of the following statements is INCORRECT?

QUESTION ID:33

Greenhouse Gas emissions are considered the primary driver of global warming through their influence on the radiative forcing of the atmosphere. This radiative forcing occurs because

QUESTION ID:34

Natural selection can maintain genetic polymorphisms. Which one of the following CAN NOT contribute to the maintenance of polymorphisms?

QUESTION ID:35

Which one of the following statements regarding the invasion of blast fungus, Magnaporthe oryzae in rice is INCORRECT?

QUESTION ID:36

Runaway selection was proposed by R. A. Fisher to explain the evolution of extravagant secondary sexual characters. The model is based on the exaggeration of characters in male, and female choice for these exaggerated characters. Which one of the following statements is considered an assumption of this model?

QUESTION ID:37

Which one of the following gases diffuses through alveolocapillary membrane in shortest time at the resting condition?

QUESTION ID:38

Mitotic cyclin increases gradually through the G2 phase of the cell cycle but the activity of mitotic CDK1 increases suddenly at the onset of M phase. This is because

QUESTION ID:39

A yeast strain has accumulated a mutation that makes it grow slowly. Investigation reveals that ribosomal RNA levels have dropped drastically in this strain. Which RNA polymerase is likely to be mutated in this strain?

QUESTION ID:40

Which one of the following is the strongest oxidizing agent produced during photosynthesis?

QUESTION ID:41

A Drosophila stock that is heterozygous null for a unique nuclear target gene was sib-mated. The target gene is essential for the development of Drosophila. The embryos from the cross were analyzed and the following results were obtained:
• PCR analysis of the genomic DNA isolated from embryos showed that 25% of the embryos did not have the target gene.
• Northern analysis of the RNA isolated from the above embryos showed the presence of transcript corresponding to the target gene.
• No lethality was observed in the progeny.
Which one of the following options can best explain the above observations?

QUESTION ID:42

Two students performed an ELISA to determine the amount of anti-Spike antibody in serum of a Covid-19 patient. They used the same ELISA plates, the same reagents for coating, blocking and detection, and the same ELISA reader.
Both generated independent standard curves of absorbance vs concentration using the same Spike protein. Student 'A' correctly reported a concentration of 100 μg/ml, but student 'B' reported 450 μg/ml. Which one of the following could most likely explain the wrong result of student 'B'?

QUESTION ID:43

Which one of the following is considered as a renal hormone?

QUESTION ID:44

When E. coli and macrophages are placed in a petri dish with medium, the macrophages internalize the E. coli into cytoplasmic vesicles called phagosomes, which then fuse with lysosomes where the bacteria are killed. If E. coli is replaced by M. tuberculosis in the petri dish, which ONE of the following options will happen after attachment of the bacteria?

QUESTION ID:45

Which of following is a likely consequence of a loss of function mutation in the gene encoding the enzyme phenylalanine ammonia-lyase (PAL) in coffee plants?

QUESTION ID:46

Which one of the following statements is correct with respect to 95% confidence interval of the estimated mean from a set of observations?

QUESTION ID:47

Which one of the following is most commonly used for barcoding-based identification of animal species?

QUESTION ID:48

The pedigree in Panel (i) represents the inheritance pattern of a given trait. Then trait is NOT 100% penetrant. Panel (ii) represents PCR amplification profile of each member of the family using a specific primer pair. (M: mother, F: father, C: child)
What is the mode of inheritance of this trait?

QUESTION ID:49

The proponents of sustainable development argue for a switch to a predominantly plant-based diet, in order to reduce the human footprint of food production. The statements given below present some of the arguments put forward by them.

QUESTION ID:50

Which one of the statements about bacterial operons is INCORRECT?

QUESTION ID:51

The pH of water in Lonar lake was found to be 10.5, 10.3, 10.1, 10.4, 10.7, and 10.4 for measurements taken once daily over six days. What would be the average pH of the lake water during this period?

QUESTION ID:52

Which one of the following statements regarding genetics of quantitative traits in plants is INCORRECT?

QUESTION ID:53

Topoisomerase activity was measured in terms of change in the linking number of DNA in the presence of Camptothecin (inhibitor of Topoisomerase I) or Etoposide (inhibitor of Topoisomerase 11). Which one of the following is the correct expected outcome?

QUESTION ID:54

Which one of the statements about homoplasy is NOT true?

QUESTION ID:55

How many molecules of acetyl-CoA condense to produce isopentenyl diphosphate, the precursor for the formation of terpenoids by mevalonate pathway?

QUESTION ID:56

Mutations in a specific mammalian signaling pathway result in early defects observed in the establishment or maintenance of midline structures, such as the notochord and the floor plate. Later defects include the absence of distal limb structures, ventral cell types within the neural tube, spinal column and most of the ribs and cyclopia. Mutations in which one of the following signaling pathways is the most reported cause for these congenital defects?

QUESTION ID:57

Which one of the following properties of grooves is a hallmark of the Z-form of DNA?

QUESTION ID:58

Normal human fibroblasts, cancer cells (that originated in stem cells) and fibroblasts transduced with hTERT (hTERT cells) were passaged for 35 generations. Southern blot analysis was performed using DNA from above cells using radio-labelled probes for telomeric sequences. Which one of the following band patterns would be observed in the autoradiogram?

QUESTION ID:59

The Burgess Shale in the Canadian Rocky Mountains is known for its Cambrian fossils. This site is abundant in which one of the following fossil assemblages?

QUESTION ID:60

Which one of the following adrenoceptors decreases cAMP in the post-synaptic target after stimulation with norepinephrine?

QUESTION ID:61

Which one of the following statements regarding the stereoisomers of oglucose is INCORRECT?

QUESTION ID:62

A 160 kOa complex of four protein molecules, consists of a dimer formed by a 25 kOa protein connected by two disulfide bonds. and three other proteins of 10, 30 and 70 kOa, respectively. It was isolated and analyzed on an SOS-PAGE gel without OTT in the gel loading dye. Which one of the following options would represent the SOS-PAGE profile?

QUESTION ID:63

Which one of the following is an example of parametric statistical test?

QUESTION ID:64

Which one of the following organisms is NOT paedomorphic?

QUESTION ID:65

In the thymus of a normal mouse, positive selection of T cells is based on recognition of which of the following?

QUESTION ID:66

The term gynodioecious species refers to plants with

QUESTION ID:67

Ian Pavlov conducted experiments to demonstrate that a dog that associates the sound of a bell with food, would salivate on hearing the bell even when the food was not presented. This is an example of

QUESTION ID:68

Which one of the following molecular phylogenetic trees depicts the correct relationship among invertebrates?

QUESTION ID:69

The following graphs represent plots for the volume (dotted lines) and bacterial viable cell count curves (solid line) for a fermenter culture.
Which one of the following corresponds to the features applicable to a fedbatch mode of fermenter culture?

QUESTION ID:70

Which ot the following describes 'Empty Forest'?

QUESTION ID:71

The following statements refer to mechanisms that may confer resistance to antibiotics in bacteria.
A. Enzymes that can break down the antibiotic.
B. Efflux systems to pump out the antibiotic.
C. CRISPR-mediated defence against the antibiotic.
D. Antitoxins that can sequester the antibiotic.
E. Cell wall modification.
Which one of the following options represent the cornbination or all correct statements?

QUESTION ID:72

In hot environment, some changes occur in the human body to improve heat tolerance, which is called heat acclimatization. The following suggested statements describe the physiological adjustments during heat acclimatization:
A. Vasoconstriction starts in skin at a lower body temperature.
B. Salt concentration in sweat is increased.
C. The sweat secretion over the skin is more effectively distributed for optimum use of the effective surface area for evaporative cooling.
D. The sweat glands maintain high output for longer periods.
E. The threshold for start of sweating is increased.
Which one of the following options represents the combination of the correct statements?

QUESTION ID:73

The following four DNA oligos are mixed in equimolar concentration, heated to 95°C, and slowly annealed in a microcentrifuge tube.
5' GCG GGA ATT TA 3'
5' GCC TAC TCC CGC 3'
5' CGA TGG GTA GGC 3'
5' TAA ATC CAT CG 3'
Which of the following secondary structures will predominantly be present?

QUESTION ID:74

Isolated mitochondria were either treated with protease or first briefly incubated in hypotonic solution prior to treatment with protease. The reaction was stopped and samples were probed for presence of Mtg2, Porin (at the outer membrane), Cyt c (in the inter-membrane space) and KOH (in the matrix) using western blot analyses.
Based on the gels above, Mtg2 is localized

QUESTION ID:75

A researcher wants to stitch two fragments of DNA, "A" and "B" (shown in the figure below), using PCR. She uses primer pairs "a" and "b" to amplify DNA "A". Thereafter, she mixes equal concentrations of PCR amplified "A" and DNA "B" to set up a PCR using primers " a' "and "c".
The plus strand sequences of the two DNA fragments are given below (" ...." stands for any of the four nucleotides):
A:  5'-AGAGAGAGAGAGAGAG ..................G AGAGAGAGAGAGAGAGAGAG - 3'
B:  5'-AGCTTGCA TGCCTGCAGGTCGACT ........................... T AGACGATGA - 3'

Which one of the following options represents the correct sequence of primer "b"?

QUESTION ID:76

Mutants of bacteriophage that carry deletions can be used to rapidly locate mutational sites of newly obtained mutants . The mapping is based on whether wild type recombinants can be recovered when the deletion mutant and the novel mutant are brought together .
Four independent deletions (1 to 4) of a region were used to map 4 novel mutations (A to D).
The deletions (starting from a fixed site) are shown below (the lines denote the region of deletion):
The results of mapping are summarized in the table, where '+' denotes the recovery of wild type recombinants and'-' the inability to do so.
Further it was observed
• that out of the 4 novel mutants no revertant was observed for mutant A
• mutant Band C do not complement each other
The following conclusions were made:
A. Mutation A lies within the region of deletion 1.
B. Mutations can be ordered as A-D -B-C.
C. Mutant A could be a deletion.
D. Mutants Band C are located on 2 independent cistrons.
Which one of the following options represents a combination of all correct statements?

QUESTION ID:77

Select the statement that describes Weberian ossicles.

QUESTION ID:78

Following statements were made for the production of cisgenic plants.
A. In cisgenics, the donor sequence does not necessarily replace the native gene sequence but is added to the recipient species.
B. Cisgenic plants might contain DNA sequences such as T-DNA borders from the plasmid vector.
C. Insertion of a cisgene may result in a gene mutation at the site of insertion similar to that of transgenics.
D. With regard to the species gene pool, cisgenesis does not alter the gene pool of the recipient species.
E. Both cisgenesis and transgenesis can use the same DNA transformation methods to introduce the respective gene constructs into the recipient plants.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:79

Given below are mammals and their location in India:

Mammal

Location

a. Hangul

i.

Little Rann of Kutch

b. Golden Langur

ii.

Manas National Park

c. Sangai

iii.

Dachigam National Park

d. Wild Ass

iv.

Keibul Lamjao National Park

Which one of the following options represents the correct match between the mammals and their locations?

QUESTION ID:80

The cadherin catenin complex is extremely important duiring compaction from a morula to the blastula. Transition of early embryonic cells into a blastula differed depending on the presence or absence of calcium ions. In addition, an investigator blocked the expression of β-catenin using vivo morpholinos to detect its effect simultaneously on compaction. Which one of the following conditions will lead to the most successful transition of the morula into the blastula?

QUESTION ID:81

A tree grows at 0.5 meter per day under optimal tropical conditions. Assuming the stem consists entirely of cellulose fibers, how many D-glucose residues must be added per second to reach the above growth rate? The length of D-glucose in cellulose is about 0.45 nm.

QUESTION ID:82

In a population with density-dependent effects on births and deaths due to intraspecific competition, the net recruitment curve is dome-shaped because

QUESTION ID:83

The statements given below indicate key characteristics of a geographical region .
A. Contains at least 1500 species of endemic animals
B. Contains at least 1500 species of endemic vascular plants
C . Has lost 70% of its original natural vegetation
D. Has lost 30% of its original natural vegetation

Which one of the following combinations represents the correct criteria for declaring an area as a biodiversity hotspot?

QUESTION ID:84

The mutation rate refers to the frequency at which new mutations arise in the genome of an organism and is typically expressed as:
Mutation rate=Number of observed mutations/Total number of opportunities for mutations
Which one of the following factors will NOT influence the opportunities for mutations?

QUESTION ID:85

Consider a species of group-living bird in which individuals produce alarm calls to alert group members of the presence of a predator. The alarm call confers fitness benefits to the caller as it helps group members (composed of genetic relatives) escape the predator. However, alarm calling also makes the caller more conspicuous to the predator. Individuals of this species in a population have four phenotypes for the loudness of alarm calls they produce in the order P < Q < R < S. The graph below gives the cost and benefit functions for alarm calling behaviour for the four phenotypes.
Which one of the following phenotype frequencies represents the correct outcome of natural selection?

QUESTION ID:86

In the figure below, which of the curves that relate current reproductive effort with future reproductive value are likely to favor semelparous reproduction?

QUESTION ID:87

The table below represents a list of geographical regions and avian fauna.

Geographical region

Avian fauna

a. Western Himalayas

i.

Rufous babbler

b. Western Ghats

ii.

Narcondam hornbill

c. Peninsular India

iii.

Red crossbill

d. Andaman-Nicobar Archipelago

iv.

Yellow-throated bulbul

Which one of the following options represents the combination of all correct matches:

QUESTION ID:88

The phylogenetic tree given below shows single nucleotide polymorphisms observed among four individuals of the scorpion species Deccanometrus benga/ensis.
Select the option that represents the correct combination of ancestral nucleotides at nodes X, Y and Z using the principle of parsimony.

QUESTION ID:89

The surface electrostatic potential map of an 18 kDa protein is shown below. Shades of blue and red on the surface denote positively and negatively charged surfaces, respectively.
Which one of the options represents the most likely natural substrate/s for the protein?

QUESTION ID:90

A region of a eukaryotic chromosome is heavily transcribed by RNA polymerase-
ll. Given below are a few properties of such a chromatin.
A. DNasel hypersensitivity
B. High CpG methylation
C. Occupied by macroH2A
D. High histone acetylation

Choose the option that has all correct properties.

QUESTION ID:91

Different segments of the renal tubule (Column X) and the sodium transporter in the apical membrane of tubular cells (Column Y) are listed below:

Column X

Column Y

Renal tubular segment

Apical transporter

a. Proximal tubule

i

Na+ channel (ENaC)

b. Collecting duct

ii

Na+−K+−2Cl- co-transporter

c. Thick ascending limb

iii

Na+−Cl- co-transporter

d. Distal convoluted tubule

iv

Na+-amino acid co-transporter

Which one of the following options represents the correct match between Column X and Column Y?

QUESTION ID:92

In the table given below, match the national parks with the mountain range in India where they are located.

National parks

Mountain range

P. Silent Valley

i.

Western Ghats

Q. Neora Valley

ii.

Eastern Himalayas

R. Valley of Flowers

iii.

Western Himalayas

S. Pin Valley

Which one of the following options represents all correct combinations?

QUESTION ID:93

Protein A binds the mRNA for gene B in Hela cells. The protein A mediates the formation of mRNA-protein particles (mRNPs). The addition of a chemical C disrupts mRNPs in Hela cells. The results of the western blot and northern blot analyses are shown below:

From the above experiments, which one of the following statements is true?

QUESTION ID:94

Different phases of a typical nerve fibre action potential are explained in the following statements:
A. The membrane potential is brought to the threshold potential (firing level) due to the opening of some voltage-gated sodium channels in response to a threshold depolarizing stimulus.
B. The rapid depolarization after the firing level is caused by opening of more voltage-gated sodium channels and entry of Na+ into the nerve fibre.
C. The reversal of membrane potential (overshoot) at the peak of action potential occurs as membrane potential moves towards the equilibrium potential of K+.
D. The peak voltage of action potential does not reach the equilibrium potential of K+ primarily because the increase of K+ conductance is short-lived.

Which one of the following options represents the combination of the correct statements?

QUESTION ID:95

Male mating systems have evolved in response to female mating strategies and ecological factors that determine spatial distribution of females. In the table given below, column A represents different mating systems and column B represents different ecological conditions.

Column A

Column B

P. Resource defense polygyny

i.

Resource is abundant and occurs all over the habitat

Q. Lek Mating

ii.

Resource is abundant and occurs in clumps

R. Monogamy

iii.

Resource is limited and occurrence is unpredictable

Which one of the following statements represents all correct combinations for the kind of mating system with the corresponding ecological condition?

QUESTION ID:96

Following are certain statements regarding NADP-malic enzyme type of C4 photosynthesis:
A. Malate synthesized from oxaloacetate in mesophyll cells is transported to bundle sheath cells.
B. Pyruvate formed in the bundle sheath cells is transported to mesophyll cells.
C. Aspartate synthesized from oxaloacetate in mesophyll cells is transported to the bundle sheath cells and again gets converted into oxaloacetate.
D. Alanine aminotransferase converts pyruvate into alanine in the bundle sheath cells.
E. Oxaloacetate is converted into aspartate, by aspartate aminotransferase in the mesophyll cell.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:97

A receptor tyrosine kinase (RTK) dimerizes and autophosphorylates in presence of a ligand. A researcher prepares three constructs that express either the (A) full-length protein having a kinase domain as well as 3 tyrosine residues, (B) the RTK with a non functional kinase domain but with the 3 tyrosine residues, and (C) the RTK lacking the 3 tyrosine residues but having a functional kinase domain. She expressed these constructs in cell lines lacking the RTK, either singly or in combinations shown in the figure, breaks open the cell and added the ligand of the RTK in presence of radio-labelled ATP. She immunoprecipitated the RTK and analysed the immunoprecipitates by Coomassie staining as shown in the figure, followed by autoradiography.

Which one of the following autoradiograms would the researcher expect?

QUESTION ID:98

Match the major cell cycle regulatory proteins in Column (X) and their typical function in Column (Y)

Column X

Column Y

A. Wee1

(i)

suppresses G1/S-Cdk and S-Cdk activities after DNA damage

B. p27

(ii)

phosphorylates inhibitory sites in Cdk

C. p21

(iii)

activates APC/C in late mitosis and early G1 phase

D. Cdh1

(iv)

suppresses G1/S-Cdk and S-Cdk activities in G1 phase

Which one of the following options represents the correct match between column X and column Y?  

QUESTION ID:99

An enzyme has a Km of 1 mM. Addition of different inhibitors changes Km and/or Vmax given as Kmapp and Vmaxapp (app for apparent), respecitively. Which one of the following inhibitors will result in the lowest rate of enzyme-catalyzed reaction? 

QUESTION ID:100

Given below are a few statements related to inheritance biology.
A. Quantitative traits are characterized by discontinuous variations in the phenotype.
B. Polygenic traits never show a normal distribution of phenotypic variability.
C. Association mapping captures wider genetic diversity than biparental linkage mapping.
D. Bulked segregant analysis can be used for mapping of monogenic qualitative traits.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:101

In a quadrat sample for tree species in a plantation, 20 species were found in almost equal abundance. The Shannon's index of diversity is approximately

QUESTION ID:102

The following statements are made regarding formulation of the advanced candidate antimalaria vaccine RTS,S.
A. It contains heat-killed Plasmodium fa/ciparum sporozoites and Hepatitis B surface antigen.
B. It contains formalin-inactivated P/asmodium falciparum sporozoites and attenuated poliovirus.
C. It contains a fusion protein between Plasmodium falciparum CSP Cterminal region and Hepatitis B surface antigen.
D. It contains a fusion protein between P/asmodium falciparum Merozoitesurface protein and CSP.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:103

Given below are a list of sub-cellular compartments (Column X) and markers (Column Y).

Column X

Column Y

Subcellular compartments

Markers

A Endoplasmic reticulum

i

LC3b

B Golgi apparatus

ii

HSP60

C Autophagosome

iii

Protein disulphide isomerase

D Mitochondria

iv

Mannosidase II

Which one of the following options correctly matches the subcellular compartments with their markers?  

QUESTION ID:104

The following statements are made about the killing of virus-infected respiratory epithelial cells by cytotoxic T cells:
A. Priming of the T cells has taken place in thymus, lymph node or spleen.
B. Viral antigens have been presented on infected epithelial cells.
C. MHC-I molecules have been presented on infected epithelial cells.
D. MHC-11 molecules have been presented on infected epithelial cells.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:105

Plants perceive effector molecules of a pathogen and mount a series of events that lead to the activation of a defense response. Following statements are made with respect to events that occur within a few minutes of the effector perception.
A. Transient change in the ion permeability of the plasma membrane .
B. Efflux of K+ and cl- ions from the cell.
C. Influx of ca2+ and H + ions into the cell.
D. Influx of K+ and cl- ions into the cell and efflux of ca2+ and H+ ions from the cell.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:106

According to ABCDE model of flower development, different combinations of MADS box proteins belonging to class A, B, C, D and E bind to each other to form a tetrameric structure referred to as "floral quartet" as given below. The floral quartet bind to DNA to activate transcription of the genes needed to specify each floral organ types.
AP1 = APETALA 1, AP3 = APETALA 3, Pl= PISTILLATA, AG= AGAMOUS
STK = SEEDSTICK, SHP = SHATTEKPKOOF, SEP= SEPALLATA 1/2/3


Which one of the following options represents the combination of floral quartets that specify petals and carpel whorl of flower, respectively?

QUESTION ID:107

Wild-type Drosophila have a pair of wings on one segment and a pair of halteres on the adjacent posterior segment. Wild type four-winged insects like dragonflies do not have halteres. Ultrabithorax (Ubx) is a homeobox gene. Ubx mutants of Drosophila have two pairs of wings and no halteres. In relation to Ubx function, the two-winged and four-winged insect species differ based on

QUESTION ID:108

The figure summarizes the observation following a cross between two haploid strains of Neurospora crassa having alleles A and a, respectively.

 

The following statements were made:

A. In 'I', segregation of alleles occurred in Anaphase II.

B. Crossing over between the centromere and the gene occurred in 20% of the meiocytes.

C. With reference to the two non-recombinant parental chromosomes, there are 6 different ways by which they can orient themselves at the equatorial plate.

D. The gene is 20cM away from the centromere.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:109

Certain statements are made below about hemoglobin.
A. HbA1c has glucose attached to the terminal valine i n each β chain.
B. NADH-methemoglobin reductase system in RBC converts methemoglobin to hemoglobin.
C. 02 binds to the Fe2+ in the heme moiety of hemoglobin to form oxyhemoglobin.
D. The affinity of hemoglobin for 02 is much higher than that of its affinity for carbon monoxide.

Which one of the following options represents combination of all correct statements?

QUESTION ID:110

Different leads used in electrocardiography (Column X) and the electrode placement and connections (Column Y) are listed below: 

Column X

Column Y

ECG leads

Electrode placement and connections

a. Standard limb lead I

i

Left leg - positive

Right arm - negative

b. Standard limb lead II

ii

Left leg- positive

Left arm- negative

c. Standard limb lead III

iii

Right arm- positive,

Left arm and left leg connected together- negative

d. Augmented limb lead aVR

iv

Left arm - positive

Right arm - negative

Which one of the following options represents the correct match between Column X and Column Y?

QUESTION ID:111

The following tree shows phylogenetic relationships between species A to D

Which of the following molecular mechanisms would be responsible for the phylogenetic relationships shown between species A to D?

QUESTION ID:112

Single-stranded DNA binding properties of three DNA repair proteins (A, B, and C) were investigated. A biotinylated single-stranded DNA was prepared and incubated with the proteins in different combinations as shown below. This was followed by streptavidin pull-down to enrich ssDNA-bound proteins, which were detected by western blot analyses using specific antibodies.
Which one of the following statements is NOT a correct conclusion from the above study?

QUESTION ID:113

Given below is the list of F-box proteins of the SCF ubiquitin E3 ligase complex (Column X) and their associated regulatory proteins of phytohormone pathways (Column Y).

Column X

Column Y

A. TIR1

i.

Degradation of JAZ repressor protein

B. COI1

ii.

Targets the transcription activator EIN3 for degradation

C. SLY1

iii.

Degradation of AUX/IAA repressor protein

D. EBF1

iv.

Degradation of GID1-bound DELLA repressor

Which of the following combinations represents the correct match between Column X and Column Y?

QUESTION ID:114

Stable coexistence is possible in a classical two-species Lotka-Volterra competition model when

QUESTION ID:115

Following statements have been made about vaccines.
A. Covaxin is a killed cell vaccine and Corbevax is a subunit vaccine.
B. Oral polio vaccine is given as a live attenuated vaccine to adults and as a killed vaccine to children.
C. Third generation vaccines against smallpox are based on attenuated Vaccinia virus.
D. MMR vaccine is given to children to protect them against diphtheria.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:116

The following experimental manipulations were carried out with Xenopus embryo.
Manipulation X: Exposure to ultra violet radiation leading to the failure of cortical rotation.
Manipulation Y: Gastrulae treated with lithium chloride, an agonist of canonical Wnt signaling.
The following statements were made with respect to the above manipulations and genes involved in setting up dorso-ventral polarity in amphibians.
A The phenotype obtained due to manipulation X can be rescued by injection of noggin in 1-cell embryo
B. Chordin mRNA will be enriched in embryos of manipulation X as compared to those of manipulation Y
C. Injection of cDNA for chordin into ventral blastomeres leads to the induction of a secondary axis.
D. Experimentally depleting 13-catenin transcripts in 1-cell embryo by antisense oligonucleotides leads to phenotype similar to that obtained from manipulation X.

Which one of the following options represents all correct statements?

QUESTION ID:117

To test the lever-arm model of myosin movement, an investigator utilizes recombinant DNA technology to attach myosin head to various length of neck domains. In the schematics shown below (1-4 ), the y-axis represents the velocity of myosin in μm/sec on the actin filament, and the x-axis shows the recombinant myosins (a-d; shown on the left) that were utilized to calculate the velocity. Considering that all the appropriate conditions were applied to estimate the velocity of recombinant myosin, choose the graph that correctly represents the velocity of recombinant myosin.

QUESTION ID:118

DELLA proteins are known to interact with phytochrome interacting factors (PIFs) and regulate genes involved in etiolation in Arabidopsis. Following are certain statements regarding the function of DELLAs under dark and light conditions:
A. In dark, high level of gibberellic acid (GA) helps DELLAs to directly bind to PIFs.
B. During light, the level of GA goes down and helps DELLA-PIF complex to bind to the promoters of the etiolation responsive genes.
C. Binding of DELLA proteins to PIFs prevents the transcription of PIFinduced genes, leading to photomorphogenesis.
D. Skotomorphogenesis is due to the degradation of DELLA proteins and binding of the PIFs to the etiolation responsive genes.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:119

Given below is a PONDR (Predictor of Natural Disordered Regions) score-plot versus the protein sequence.

Based on the above figure, which one of the following statements is correct?

QUESTION ID:120

The glomerular ultrafiltration coefficient (Kf) can be changed by the mesangial cells producing a decrease in Kf largely due to a reduction in the area available for filtration. The following statements are made about some agents that affect the mesangial cells.
A. Norepinephrine causes contraction of mesangial cells.
B. Angiotensin II causes relaxation of mesangial cells.
C. Histamine causes relaxation of mesangial cells.
D. Atrial natriuretic factor (ANF) causes relaxation of mesangial cells.

Which one of the following options represents combination of all correct statements?

QUESTION ID:121

The following graphs represent the effect of two environmental conditions (E1 and E2) resulting in two optimal phenotypes (OE1 and OE2) for their respective environmental conditions. 

Which one of the options represents phenotypic plasticity? 

QUESTION ID:122

Results of immunoprecipitation (IP) of HA-Yfg are shown below .

 

Given below are options of controls that could be used to confirm that F1β actually associates with HA-Yfg.

A. Include a lane where α-HA is not added but Protein A-Sepharose is added

B. Include a lane where neither α-HA nor Protein A-Sepharose are added

C. Include a lane where α-HA is added but Protein A-Sepharose is not added

D. Include a lane where α-Myc is added instead of α-HA before addition of Protein A-Sepharose.

Which one of the following options represent(s) the most appropriate control(s)?

QUESTION ID:123

A decapeptide composed of MFTGPYCPRW was dissolved in 20 mM HEPES (pH 7.0), 50 mM NaCl, 50 mM Na2S04, 5 mM OTT, and 4 mM EDTA. Which one of the following statements about the peptide in the given buffer conditions is correct?

QUESTION ID:124

The following statements summarize metamorphosis and regeneration.
A. Many changes during amphibian metamorphosis are regionally specific. Although the tail epidermis never dies, the head epidermis does.
B. In neoteny, the juvenile form is slowed down, while the gonads and germ cells mature at their normal rate.
C. In epimorphosis, tissues never dedifferentiate into a blastema, divide, or re-differentiate into the new structure.
D. In the regenerating salamander limb, the epidermis forms an apical ectodermal cap. The cells beneath it dedifferentiates to form a blastema.
E. In hydras, there appear to be head activation gradients, head inhibition gradients, foot activation gradients, and foot inhibition gradients.

Which one of the following options has the correct combination of statements that will lead to normal developmental outcome in organisms?

QUESTION ID:125

Protein phosphatase 2A (PP2A) is a critical regulator of Cdk1 substrates during the cell cycle. The B55 subunit of PP2A influences the substrate selectivity, localization, and regulation of the enzyme. Given below are a few statements about PP2A and its regulation during the M-phase of the cell cycle.
A. PP2A-B55 activity is high during interphase but inhibited during early mitosis when M-Cdk activity rises.
B. M-Cdk1 turns off PP2A-B55 via the phosphorylation of an intermediary protein kinase called Greatwall.
C. M-Cdk1 turns on PP2A-B55 via the phosphorylation of an intermediary protein kinase called Greatwall.
D. When anaphase is initiated and M-Cdk1 activity declines, PP2A-B55 promotes dephosphorylation of Cdk1 substrates

Which one of the following combinations represents all the correct statements?

QUESTION ID:126

Following are a few statements made regarding the lac operon.
A. The LacZ, LacY and LacA are encoded by a single transcript.
B. The three proteins are translated as a single precursor and then processed.
C. In the presence of glucose, lactose can upregulate the operon.
D. lsopropyl thio β-D-galactoside (IPTG) is a gratuitous inducer.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:127

Following are the different critical reaction steps involved in the oxidation of lipids in many organisms.
A. Reaction of fatty acyl-CoA with carnitine
B. Thiolysis
C. Hydrolysis of triacylglycerol by lipase
D. Activation of fatty acid by conjugating to CoA
E. Hydration

Choose the correct sequence of reaction steps in ascending order.

QUESTION ID:128

A cancer cell line obtained from a rat glioma tumour was stained with the nuclear dye Hoechst 33342 and sorted using FAGS. About 0.4% of the population stained lightly (LSP), distinct from the densely stained population of cells (DSP). Equal number of cells from these two populations were subcutaneously implanted into a suitable animal model to develop tumours. Following statements are made from this experiment:
A. The LSP cells will give rise to tumours.
B. The DSP cells will give rise to tumours.
C. The LSP cells can give rise to LSP and DSP cells.
D. The DSP cells can give rise to LSP and DSP cells.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:129

Changes in plasma osmolarity and extracellular fluid (ECF) volume affect thirst by separate pathways as given in the following statements.
A. Hypertonicity leads to osmoreceptor activation giving rise to hypothalamic control of thirst.
B. Hypertonicity leads to baroreceptor activation giving rise to hypothalamic control of thirst.
C. Hypovolemia leads to activation of baroreceptor and angiotensin II giving rise to hypothalamic control of thirst.
D. Hypovolemia leads to osmoreceptor activation giving rise to hypothalamic control of thirst.

Which one of the following options represents combination of all correct statements?

QUESTION ID:130

Five different strains of Salmonella (1, 2, 3, 4, 5) which can utilize lactose (Lac+ ) as the sole carbon source but cannot synthesize arginine (Arg-) are mixed with five other strains (6,7,8,9,10) that cannot utilize lactose (Lac-) and can make arginine (Arg+). These strains are mixed in all possible combinations and plated on appropriate plates to get Lac+ Arg+ recombinants. The following results were obtained, where H represents 'high numbers of recombinants', L refers to 'low numbers of recombinants' and O represents 'no recombinants'.

On the basis of these results, the sex type (either Hfr, f + or F-) to each of these

strains was assigned .

A. Strains 2,3,6,7 are F-

B. Strains 2,3,5,6,7,9 are F-

C. Strains 1,4,8,10 are F +

D. Strains 1,4,8,10 are Hfr

Which one of the following options represents a combination of all correct statements?

QUESTION ID:131

The following statements are made about how CD4 T cells provide help to CD8 T cells.
A. Antigen/MHC-11 complexes on CD4 T cells interact with antigen/MHC-1 complexes on CD8 cells.
B. A single dendritic cell (DC) presents antigen on MHC-1 and MHC-11 at the same time.
C. CD4 T cells activate DCs which produce chemokines like CCL3 and CCL4 that can specifically attract CD8 T cells to form a CD4-CD8-DC triad.
D. CD4 T cells help B cells, which differentiate into plasma cells and secrete antibodies that form immune complexes which bind to FcyRs on CD8 T cells.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:132

Eukaryotic transcription factors TF1 and TF2 bind to independent cis regulatory elements (Cis1 and Cis2, respectively) upstream of TATA box and positively regulate gene expression. Histone modifier 1 (HM1) binds to TF1 but not to TF2. In order to determine how genes are regulated by these three factors, an in vitro transcription and translation assay was set up. A packaged DNA containing region from Cis1 to Cis2, along with eukaryotic minimal promoter fused upstream of a luciferase gene, was purified. The luciferase activity, upon addition of a combination of TF1, TF2 and/or HM1, in presence ofr RNA polymerase and translation mix is plotted below .

 Which one of the following models best represents the results above? 

QUESTION ID:133

Asynchronous cultures of E. coli were grown in 14N and then shifted to 15N medium containing a chemical C (0 minute) and incubated for two generation times (i.e. 40 minutes). Proportion of hybrid DNA ( 14N-15N) was measured at various time-points and results are depicted in the following table. 

From the data, it was concluded that the chemical C inhibits DNA replication.

Which one of the following possibilities could be the likely mode of action of chemical C?

QUESTION ID:134

Fgf8 expression in the anterior developing mouse brain induces anterior identity marker expression (anteriorization). The Fgf8 receptor is uniformly expressed in the brain. Which one of the following experiments best demonstrates this fact?

QUESTION ID:135

Salicylic acid (SA) regulates hypersensitive response and effector-triggered immunity at the primary infection site and systemic acquired resistance (SAR) in the distal tissues of the plants. Which one of the following statements regarding the functionality of the Non-expressor of PR genes 1 (NPR 1) in the distal tissue is correct?

QUESTION ID:136

A uniformly labelled (32P) single-stranded DNA (ssDNA) was incubated with a homologous double-stranded DNA (dsDNA) in the presence of Rad51 and/or RPA along with ATP or the non-hydrolysable ATPγS to study a three-strand exchange reaction. The reactions were terminated at various time points, DNA were digested with EcoR/ followed by

Based on the above data, which one of the following statements is INCORRECT?

QUESTION ID:137

A cross was made between wild type female Drosophila melanogaster and mutant males which are yellow bodied (y) and crossveinless (cv). The two genes are present on the X-chromosome. The F1 progeny was sib-mated and the observation of F2 progeny is tabulated below.

Phenotype

No. of male progeny

No. of female progeny

wild type

45

100

yellow body and crossveinless

40

0

yellow body

6

0

crossveinless

9

0

Total no. of progeny analyzed = 200

With regard to the above analysis, which one of the following statements is correct?

QUESTION ID:138

The following statements describe possible nomenclature rules for plants and animals.
A. A plant and an animal cannot bear the same binomial latin name.
B. The valid name of a tax on is the oldest available name that has been applied to it and which is validly published.
C. A species may not be removed from a genus once described.
D. Only a single specimen 'holotype' acts as the primary "name bearer" for any species.

Select the option that contains all accepted statements about nomenclature rules.

QUESTION ID:139

In a plant species, the following pathways contribute to seed color. The wild type phenotype of seed color is red. 

• A recessive mutation of gene A leads to white color pigment.

• A recessive mutation of gene B leads to a transparent outer layer and the color of the seed is based on the color of the endosperm.

• The two genes are present on two different chromosomes.

• Often, a yellow or white colored seed has red spots.


Based on the above information, the following statements were made:

A. The probability of getting red colored seeds from a dihybrid cross involving two heterozygous mutants is 9/16.

B. The mutation in gene B could have been caused by a transposable element.

C. A plant producing red seeds would breed true for the seed color.


Which one of the following options represents a combination of all correct statements?

QUESTION ID:140

The exponential growth equation dN/dt expresses the rate of population growth as the per capita rate of increase, r times population size N. This exponential model of population growth can be modified to produce a model in which population growth is sigmoidal by adding an element that slows growth, as population size approaches carrying capacity, K. If the per capita rate of increase rmax is the maximum per capita rate of increase, then select the correct option for the logistic equation for population growth. 

QUESTION ID:141

The steady state level of a plant metabolite 'M' is determined by the complex interplay of its biosynthesis, catabolism and transport processes from the source to the sink organ. A researcher tested following molecular and genetic strategies for engineering the metabolite 'M' in the native host plant.
A. Increasing catalytic efficiency of its rate-limiting biosynthetic enzyme in the source organ .
B. Increasing catalytic efficiency of the catabolic enzymes in the source organ.
C. Generating knock-out of the transporter protein in the source organ.
D. Repression of the catabolic enzymes in the sink organ.

Which of the above-mentioned strategies will provide a higher accumulation of the target metabolite 'M' in the sink organ?

QUESTION ID:142

The lines (A to D) in the graphs represent trait relationships that capture the allocations of different tree species to their present reproduction versus present growth, and their offspring number versus offspring size.

An isolated patch of forest land with nutrient-rich soils was recently cleared for timber. Which one of the options represents the correct combination of trait relationships that are most likely in the tree species that will invade and thrive in the early stages of secondary succession?

QUESTION ID:143

The feedback control of the branched amino acid biosynthesis pathway in Arabidopsis is given below. The activity of Acetohydroxyacid Synthase (AHAS) enzyme is feedback inhibited by Leucine and Valine synergistically, whereas lsopropyl malate synthase (IPMS) enzyme activity is inhibited by Leucine only. Feedback resistant mutant lines of AHAS and /PMS genes are ahas2-1D and ipmst-1D, respectively.

 

The phenotype of these feedback resistant mutants was analyzed by growing them in the following Murashige and Skoog (MS) medium combinations.

A. MS medium only

B. MS medium supplemented with Leu only

C. MS medium supplemented with Val + Leu

D. MS medium supplemented with Val only


Which one of the following statements is correct?

QUESTION ID:144

A DNA sequence is given below:
5' -A TGACGA TGACGAGACGATGCAGATGA T AGCAGT AGCGAA TGAC -3'
The following primers were designed to amplify the above sequence:

A. 5' -T ACTGCT -3'
B. 5' -CAGTAAG -3'
C. 5' -ATGACGA-3'
D. 5' - GTCATTC - 3'
E. 5' -TCGTCAT -3'
F. 5' - GAATGAC-3'
If we negate the effects of primer length, Tm, %GC and other factors,

which one of the following options represents a combination of primers that could amplify the above DNA sequence?

QUESTION ID:145

Given below is a list of regulatory RNAs (Column X) and their modes of action (Column Y).

Column X

Column Y

Regulatory RNA

Mechanism for the control of gene expression

A. Riboswitch

i.

Base-pairing with specific mRNAs and controlling their stability and their translation.

B. MicroRNA (miRNA)

ii.

Change their conformation when bound to small molecules, usually metabolites.

C. Small interfering RNAs (siRNAs)

iii.

Complementary base pairing followed by RISC-mediated mRNA cleavage.

Which one of the following options represents all correct matches between Column X and Column Y?