Protein S will fold into its native conformation only when protein Q is also present in the solution.  However, protein Q can fold into its native conformation without protein S.  Protein Q, therefore, may function as a ____________ for protein S.

TLS Online TPP Program

#Question id: 14106

#SCPH05 I Biotechnology

The primary sources involved in OWL, which is a composite database includes all except

TLS Online TPP Program

#Question id: 27709

#Research Methodology

Social Science try to explain …………. Between human activities and natural laws governing them

TLS Online TPP Program

#Question id: 4915

#SCPH28 | Zoology

When an albino female plant of maize is crossed with normal green male plant, all plants in the progeny are albino because

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 11065

#I Life Science/ Life Sciences Group – I-V

A liquid-ventilated lung compared to a gas-ventilated lung