A primary reason that the kidneys have one of the highest metabolic rates of all body organs is that ________.

TLS Online TPP Program

#Question id: 14253

#SCPH05 I Biotechnology

Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  Determine the volume of the packed bed for 95% glucose conversion. Bed diameter is D0 = 0.2 m. Neglect the growth of the hybridomas and assume first order kinetics. 

TLS Online TPP Program

#Question id: 23243

#SCPH28 | Zoology

In Maxam gilbert DNA sequencing autoradiogram is used for band visualization. What modification leads to band visualization?

TLS Online TPP Program

#Question id: 5081

#SCPH01 Biochemistry

 The vegetal pole of a frog zygote differs from the animal pole in that ________.

TLS Online TPP Program

#Question id: 1618

#SCPH28 | Zoology

Which of the following is NOT an acute phase protein?

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG