TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 13096
#SCPH06 I Botany
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 11404
#SCPH06 I Botany
You were discovered 4 species in forest, their characteristic as following,
A specie eat only bamboo;
B species eat fruits of many tree species;
C species Short life span;
D species low population variability .
Which of the following species characteristics have been proposed as more prone to extinct?
TLS Online TPP Program
#Question id: 3884
#SCPH05 I Biotechnology
Compared with DNA polymerase, reverse transcriptase:
TLS Online TPP Program
#Question id: 18689
#I Life Science/ Life Sciences Group – I-V
Ab initio approach makes structural predictions based on
TLS Online TPP Program
#Question id: 11201
#I Life Science/ Life Sciences Group – I-V
Why are action potentials usually conducted in one direction?