Which statement best characterizes the behavior of a bacterial culture during EXPONENTIAL GROWTH?

TLS Online TPP Program

#Question id: 14679

#SCPH05 I Biotechnology

Convert 100°C to (a) K, (b) °F, and (c) °R.

TLS Online TPP Program

#Question id: 5227

#SCPH06 I Botany

One of the characteristics of retrotransposons is that

TLS Online TPP Program

#Question id: 13096

#SCPH05 I Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 337

#SCPH05 I Biotechnology

Which statement below is true about the relative lifetime of a hydrogen bond, compared to the rate of water’s ionization to hydroxide ions and hydronium ions?

TLS Online TPP Program

#Question id: 19304

#SCPH01 Biochemistry

What happens to signal peptides after the protein has been translocated to the desired location, to generate the mature functional proteins