Materials translocated in the phloem, such as sucrose, amino acids, hormones and some inorganic ions. Some inorganic solutes that move in the phloem called mobile elements. In contrast, some are relatively immobile in the phloem.

A) Immobile elements

B) Mobile elements

i) potassium, magnesium, phosphate, and chloride

ii) caesium, zinc, magnesium and iron

iii) nitrate, calcium, sulfur, and iron

iv) potassium, calcium, cobalt and caesium

Which of the following are the correct match of mobile and immobile elements in the phloem?

TLS Online TPP Program

#Question id: 5058

#I Life Science/ Life Sciences Group – I-V

 In the formation of vertebrate eye, optic vesicle and head ectoderm are-

TLS Online TPP Program

#Question id: 19380

#SCPH28 | Zoology

Glyphosate results primarily from starving the cells of aromatic amino acids, which leads to

TLS Online TPP Program

#Question id: 783

#SCPH06 I Botany

Which of the statements below is FALSE?

TLS Online TPP Program

#Question id: 13101

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 51

#SCPH01 Biochemistry

 If the equilibrium constant, Keq, for the reaction ATP → ADP + Pi is 2.22 × 10⁵ M, calculate the standard free-energy change, ΔG°, for the synthesis of ATP from ADP and Pi at 25 °C.