Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 39811
TLS Online TPP Program

#Question id: 313

What is the difference between a particle being hydrated versus being solvated?

#SCPH05 I Biotechnology

  1. A hydrated particle is surrounded by a shell of water. A solvated molecule is surrounded by a shell of solvent molecules, not necessarily water.

  2. The terms hydrated and solvated mean exactly the same thing.

  3. A hydrated particle has reacted with hydrogen. A solvated particle is dissolved in a solvent.

  4. The word hydrated is used only when the solute is an electrolyte.

More Questions
TLS Online TPP Program

#Question id: 15713

#SCPH28 | Zoology

A relatively ______ concentration of auxin favours cell proliferation and root differentiation while _______levels of cytokinin promote bud differentiation.
TLS Online TPP Program

#Question id: 13100

#SCPH06 I Botany

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?
TLS Online TPP Program

#Question id: 18220

#SCPH01 Biochemistry

Which of the following are the subtype of RNA structure
TLS Online TPP Program

#Question id: 19655

#SCPH05 I Biotechnology

Which of the following statements about SN2 mechanisms is incorrect?
TLS Online TPP Program

#Question id: 471

#SCPH05 I Biotechnology

The conversion of 1 mol of fructose 1,6-bisphosphate to 2 mol of pyruvate by the glycolytic pathway results in a net formation of: