The molar ratio of sodium acetate to acetic acid in a buffer solution with a pH OF 5.76 is 10:1. Assuming the total buffer concentration is 2.2 X 10^-2 mol/L, how many grams of sodium acetate (m.w. 82) and how many grams of acetic acid (m.w. 60) should be used in preparing a litre of the solution?

TLS Online TPP Program

#Question id: 1638

#SCPH28 | Zoology

Intracellular parasites within macrophages are killed more readily in the presence of:

TLS Online TPP Program

#Question id: 3694

#SCPH28 | Zoology

 In eukaryotes, DNA polymerase alpha is a multi-subunit enzyme with different functions. They include:

TLS Online TPP Program

#Question id: 675

#I Life Science/ Life Sciences Group – I-V

Which statement is not true about an α-helix?

TLS Online TPP Program

#Question id: 13101

#SCPH06 I Botany

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 15638

#SCPH28 | Zoology

You have isolated two mutations that show decreased expression of the Lac operon. However, unlike like the promoter mutations, these mutations don’t respond to the inducer IPTG. These mutations, designated Lac3– and Lac4–, are evaluated for the quantity of ß-galactosidase and permease activity expressed with or without IPTG:

 

Mapping experiments reveal that Lac3– and Lac4– are different short deletions located in the region before the start of the LacZ gene. Given the data shown above suggest which genetic element(s) in addition to part of the promoter has been deleted in each mutant.