TLS Online TPP Program

#Question id: 384


A solution was prepared by dissolving 0.02 moles of acetic acid (HOAc; pKa = 4.8) in water to give 1 liter of solution. What is the pH? To this solution was then added 0.008 moles of concentrated sodium hydroxide (NaOH). What is the new pH? (In this problem, you may ignore changes in volume due to the addition of NaOH).

#SCPH05 I Biotechnology
  1. 7.09

  2. 5.42

  3. 4.63

  4. 8.54

More Questions
TLS Online TPP Program

#Question id: 19836

#SCPH05 I Biotechnology

Which of the following molecule possesses highest diplopic movement ?

TLS Online TPP Program

#Question id: 823

#I Life Science/ Life Sciences Group – I-V

chaotropic agents such as guanidinium ion and urea, the efficiency of the chaotropic agent is measured in terms of-

TLS Online TPP Program

#Question id: 13100

#SCPH28 | Zoology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 3031

#SCPH28 | Zoology

In the growth equation: n = 3.3 (log10 N – log10 No), n stands for

TLS Online TPP Program

#Question id: 10523

#I Life Science/ Life Sciences Group – I-V

Conifer resin ducts, which are found in the cortex and phloem, contain a mixture of diverse terpenoids, which are released immediately upon damage by herbivores such as;

a) monocyclic terpenes like- limonene and terpinolene

b) bicyclic monoterpenes- α-pinene and β-pinene

c) tricyclic sesquiterpenes- longifolene, caryophyllene, and δ-cadinene

d) tetracyclic terpenes- longifolene, tetra-terpinolene terpenoids are incorrect?