How many complete turns are there in an ideal α-helix that contains 15 amino acids and has a pitch of 0.54 nm and a rise of 0.15 nm?

TLS Online TPP Program

#Question id: 10800

#SCPH05 I Biotechnology

Which of the following secondary metabolites causes infertility in the

TLS Online TPP Program

#Question id: 3680

#SCPH05 I Biotechnology

If DNA polymerase I were mutated so that all its enzymatic activities were inactive, which part of replication would be most affected?

TLS Online TPP Program

#Question id: 13096

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 11087

#I Life Science/ Life Sciences Group – I-V

Which of the following oxygen-hemoglobin dissociation curves corresponds to normal blood (red line) and blood containing carbon monoxide (green line)?

TLS Online TPP Program

#Question id: 1681

#I Life Science/ Life Sciences Group – I-V

What do MHC class III genes encode?