Which statement is not true about an α-helix?

TLS Online TPP Program

#Question id: 13095

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 747

#SCPH01 Biochemistry

In nucleic acids, the bases are covalently attached to the 1-position of a pentose sugar ring, to form a:

TLS Online TPP Program

#Question id: 5550

#SCPH28 | Zoology

The vertebrate nervous system is derived from

TLS Online TPP Program

#Question id: 18615

#SCPH06 I Botany

PCR efficiency is influenced by several factors, the efficiency declines due to

a) efficiency of amplification declines with an increase in the length of the target sequence.

b) Efficiency of PCR is affected by primer length; it declines if the primers used for PCR arc too long.

c) a temperature higher than the ideal annealing temperature reduces PCR efficiency.

d)  primers used for PCR have complementary regions, dimers will be formed, and PCR efficiency will decline.

TLS Online TPP Program

#Question id: 9583

#SCPH06 I Botany

 A mechanism known as the Q cycle accounts for most of the observations in which structure and reactions of plastoquinone that operate in,