The correct relationship between free energy change in a reaction and the corresponding equilibrium constant KC is

TLS Online TPP Program

#Question id: 3879

#SCPH05 I Biotechnology

Which of the following is not usually essential for the catalytic activity of ribozymes?

TLS Online TPP Program

#Question id: 14157

#I Life Science/ Life Sciences Group – I-V

A ktup is composed of ___residues for protein sequences and _____ residues for DNA sequences.

TLS Online TPP Program

#Question id: 16073

#I Life Science/ Life Sciences Group – I-V

The initiation of FASTA format has ___ symbol.

TLS Online TPP Program

#Question id: 11455

#SCPH28 | Zoology

Statocysts contain cells that are ________.

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG