TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 18375
#SCPH01 Biochemistry
What is the function of Siderophores secreted by bacteria
TLS Online TPP Program
#Question id: 13096
#SCPH28 | Zoology
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 10520
#SCPH05 I Biotechnology
Which one of the following fungus causes infected rice shoots to grow much faster relative to uninfected plants and responsible for the “foolish seedling disease” of rice?
TLS Online TPP Program
#Question id: 20713
#SCPH28 | Zoology
Under anaerobic conditions and in the presence of what microbial electron transfer and respiration can proceed if suitable exogenous electron acceptors are available
TLS Online TPP Program
#Question id: 1270
#SCPH28 | Zoology
Which of the following is a major extracellular molecule in mammals containing no protein portion?