P-proteins have been characterized at the molecular level. P-proteins from the genus Cucurbita consist of two major proteins;

TLS Online TPP Program

#Question id: 3660

#SCPH06 I Botany

Which of the following is true for exchange of homologous regions between two DNA molecules?

TLS Online TPP Program

#Question id: 14118

#SCPH01 Biochemistry

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 418

#SCPH28 | Zoology

Biological oxidation-reduction reactions always involve:

TLS Online TPP Program

#Question id: 19700

#SCPH01 Biochemistry

Different leads are used to record ECG of humans, these leads can be either bipolar or unipolar. Which one of the following is NOT unipolar leads?

TLS Online TPP Program

#Question id: 10595

#SCPH28 | Zoology

If the per capita birth rate (b) and per capita death rate (d) in one year is 0.80 and 0.20 respectively. if the initial population size is 600, what will be net change (dN) in population size in one year