In conjugation the donor cell is recognized by the presence of

TLS Online TPP Program

#Question id: 5840

#SCPH28 | Zoology

The sequence of proteins used in bacterial recombination is

TLS Online TPP Program

#Question id: 19624

#SCPH05 I Biotechnology

According to Lewis concept, an acid is:

TLS Online TPP Program

#Question id: 1034

#SCPH28 | Zoology

A new drug is developed that targets and binds to the lipid A portion of LPS from Gram negative bacterial cells. This drug shows a high degree of activity and binding in a test tube setting against purified lipid A. Based on this information,

TLS Online TPP Program

#Question id: 468

#SCPH05 I Biotechnology

Glycolysis is the name given to a metabolic pathway occurring in many different cell types.  It consists of 11 enzymatic steps that convert glucose to lactic acid.  Glycolysis is an example of

TLS Online TPP Program

#Question id: 13095

#SCPH05 I Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.