How the degradation of alkanes and aromatic hydrocarbons generally occurs.

1. Oxygenase enzyme

2. β-oxidation to yield acetyl CoA

3. Hydrogenation reaction

4. Carboxylation

Which of the following are correct?

TLS Online TPP Program

#Question id: 8910

#I Life Science/ Life Sciences Group – I-V

Both animals and fungi are heterotrophic. What distinguishes animal heterotrophy from fungal heterotrophy is that only animals derive their nutrition

TLS Online TPP Program

#Question id: 7303

#SCPH28 | Zoology

The ‘quartet model’ explains how the protein products of the ABCE-function genes might interact to control floral organ identity. Following statements are based on this model. Which one of them is incorrect?

TLS Online TPP Program

#Question id: 18965

#SCPH01 Biochemistry

Select the best algorithm to do pairwise alignment when two proteins are very different in length.

TLS Online TPP Program

#Question id: 2644

#SCPH28 | Zoology

Which of these items have a positive impact on PEDCBA transcription?

TLS Online TPP Program

#Question id: 13096

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?