Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 42792
TLS Online TPP Program

#Question id: 381

Consider an acetate buffer, initially at the same pH as its pKa (4.76). When sodium hydroxide (NaOH) is mixed with this buffer, the:

#SCPH05 I Biotechnology

  1. pH rises more than if an equal amount of NaOH is added to an acetate buffer initially at pH 6.76

  2. pH rises more than if an equal amount of NaOH is added to unbuffered water at pH 4.76.

  3. ratio of acetic acid to sodium acetate in the buffer falls.

  4. sodium acetate formed precipitates because it is less soluble than acetic acid.

More Questions
TLS Online TPP Program

#Question id: 22953

#SCPH28 | Zoology

The MADS box gene form tetramers that bind to 
TLS Online TPP Program

#Question id: 1060

#SCPH28 | Zoology

If the infecting phage lacks some critical pieces of DNA necessary for replication, it is called
TLS Online TPP Program

#Question id: 3868

#SCPH28 | Zoology

The sigma factor of E. coli RNA polymerase: 
TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 14214

#SCPH05 I Biotechnology

Viscosity ranges for different impeller, find correct match?
      Types                                                                         Maximum viscosity(cp)
      P) Helical ribbon                                (I) 105
      Q) Propellers                                                                    (II)  106
      R) Helical screws                                                             (III) 104