Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 13037

#SCPH01 Biochemistry

Which of the following proteins will be most far away from the positively charged electrode during isoelectric focusing in a buffer with pH of 5?

TLS Online TPP Program

#Question id: 10508

#I Life Science/ Life Sciences Group – I-V

Glandular trichomes store species-specific secondary metabolites in a pocket formed between the cell wall and the cuticle. These secondary metabolites are-

TLS Online TPP Program

#Question id: 15463

#SCPH05 I Biotechnology

A system in which there is exchange of energy but not of mass, is called a/an    ______                 system

TLS Online TPP Program

#Question id: 10407

#I Life Science/ Life Sciences Group – I-V

Dark induce gene expression activated by___

TLS Online TPP Program

#Question id: 19353

#SCPH28 | Zoology

Gene uidA encodes the enzyme P-glucourinidase which acts on the substrate