TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#SCPH05 I Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 9582

#SCPH05 I Biotechnology

Electrons ejected from chlorophyll travel through a series of electron carriers organized in the “Z Scheme” shows a current version of the Z scheme, in which all the electron carriers known to function in electron flow from H2O to NADP Presented in the following sequence;

a.) P680 reduce by Yz has received electrons from oxidation of water P680→P680*→pheophytinplastoquinones→ cytochrome b6 f complex→ plastocyanin→ in turn reduces (PSI) P700+

b.) P700+→ P700*→ membrane-bound iron–sulfur proteins → A0→ A1 → flavoprotein ferredoxin–NADP reductase (FNR) soluble → ferredoxin(Fd) → NADP+ to NADPH

c.) P700+→ P700*→ A0→ A1→ membrane-bound iron–sulfur proteins→ ferredoxin(Fd)→ soluble flavoprotein ferredoxin–NADP reductase (FNR)→ NADP+ to NADPH

d.) P680 reduce by Yz has received electrons from oxidation of water P680→P680*→ plastoquinonespheophytin → cytochrome b6 f complex→ plastocyanin→ in turn reduces (PSI) P700+

Which one of the following combinations is correct?

TLS Online TPP Program

#Question id: 9582

#SCPH06 I Botany

Electrons ejected from chlorophyll travel through a series of electron carriers organized in the “Z Scheme” shows a current version of the Z scheme, in which all the electron carriers known to function in electron flow from H2O to NADP Presented in the following sequence;

a.) P680 reduce by Yz has received electrons from oxidation of water P680→P680*→pheophytinplastoquinones→ cytochrome b6 f complex→ plastocyanin→ in turn reduces (PSI) P700+

b.) P700+→ P700*→ membrane-bound iron–sulfur proteins → A0→ A1 → flavoprotein ferredoxin–NADP reductase (FNR) soluble → ferredoxin(Fd) → NADP+ to NADPH

c.) P700+→ P700*→ A0→ A1→ membrane-bound iron–sulfur proteins→ ferredoxin(Fd)→ soluble flavoprotein ferredoxin–NADP reductase (FNR)→ NADP+ to NADPH

d.) P680 reduce by Yz has received electrons from oxidation of water P680→P680*→ plastoquinonespheophytin → cytochrome b6 f complex→ plastocyanin→ in turn reduces (PSI) P700+

Which one of the following combinations is correct?

TLS Online TPP Program

#Question id: 9583

#SCPH05 I Biotechnology

 A mechanism known as the Q cycle accounts for most of the observations in which structure and reactions of plastoquinone that operate in,

TLS Online TPP Program

#Question id: 9583

#SCPH06 I Botany

 A mechanism known as the Q cycle accounts for most of the observations in which structure and reactions of plastoquinone that operate in,

TLS Online TPP Program

#Question id: 9584

#SCPH05 I Biotechnology

In given Relationship of oxygen production to flash energy, the first evidence for the interaction between the antenna pigments and the reaction centre, What conclusion can be drawn about based on graph;


a.) several hundred pigments are associated with each reaction centre and that each reaction centre must operate four times to produce 1 molecule of oxygen—hence the value of 2500 chlorophylls per O2

b.) low light intensity of the curve, an increase in the number of photons stimulates a proportional increase in oxygen evolution. Thus, the slope of the curve measures the quantum yield for oxygen production

c.) The quantum yield for a particular process can range from 0 →if that process does not respond to light to 1.0→if every photon absorbed contributes to the process by forming a product

d.) O2 require more than a single photochemical event to be formed, and therefore have a lower quantum yield of formation than the photochemical quantum yield. It takes about ten photons to produce one molecule of O2, so the quantum yield of O2 production is about 0.1

Which of the following statements would be correct relates with graph?

TLS Online TPP Program

#Question id: 9584

#SCPH06 I Botany

In given Relationship of oxygen production to flash energy, the first evidence for the interaction between the antenna pigments and the reaction centre, What conclusion can be drawn about based on graph;


a.) several hundred pigments are associated with each reaction centre and that each reaction centre must operate four times to produce 1 molecule of oxygen—hence the value of 2500 chlorophylls per O2

b.) low light intensity of the curve, an increase in the number of photons stimulates a proportional increase in oxygen evolution. Thus, the slope of the curve measures the quantum yield for oxygen production

c.) The quantum yield for a particular process can range from 0 →if that process does not respond to light to 1.0→if every photon absorbed contributes to the process by forming a product

d.) O2 require more than a single photochemical event to be formed, and therefore have a lower quantum yield of formation than the photochemical quantum yield. It takes about ten photons to produce one molecule of O2, so the quantum yield of O2 production is about 0.1

Which of the following statements would be correct relates with graph?