Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 15734

#SCPH05 I Biotechnology

In seed germination or seed culture process growth regulators are usually not necessary because, of

TLS Online TPP Program

#Question id: 15734

#SCPH28 | Zoology

In seed germination or seed culture process growth regulators are usually not necessary because, of

TLS Online TPP Program

#Question id: 15735

#SCPH01 Biochemistry

How meristem cultures are able to generate pathogen free plants. Choose the most appropriate statement.

TLS Online TPP Program

#Question id: 15735

#SCPH28 | Zoology

How meristem cultures are able to generate pathogen free plants. Choose the most appropriate statement.

TLS Online TPP Program

#Question id: 15736

#SCPH01 Biochemistry

In shoot regeneration which attribute may have an inhibitory effect on it

TLS Online TPP Program

#Question id: 15737

#SCPH05 I Biotechnology

The basic event of development in higher organisms is