TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 13096
#SCPH06 I Botany
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 3628
#SCPH01 Biochemistry
Two mutant plants, both bearing white flowers, were crossed. All F1 plants had red colored flowers. Which one of the following conclusions is correct?
TLS Online TPP Program
#Question id: 361
#SCPH05 I Biotechnology
Calculate the percentage of histidine that has its imidazole side chain protonated at pH 7.3. The pKa values for histidine are pK1 = 1.8, pK2 (imidazole) = 6.0, and pK3 = 9.2.
TLS Online TPP Program
#Question id: 444
#SCPH06 I Botany
Which of the following is not a factor contributing to the large free energy of hydrolysis of ATP?
TLS Online TPP Program
#Question id: 11003
#SCPH28 | Zoology
Which of the following statements about cardiac muscle is most accurate?