Match the items in group 1 with an appropriate description in group 2.

Group 1                                                                Group 2

(P) SWISS PROT                                 (1) derived protein structure database 

(Q) Local alignment                          (2) protein sequence database

(R) CATH                                             (3) GAP

(S) Global alignment                        (4) Smith–Waterman algorithm

TLS Online TPP Program

#Question id: 3670

#SCPH28 | Zoology

The best-known examples of host-encoded site-specific recombination systems used to resolve plasmid dimers are the cer-XerCD site-specific recombination systems used by the

TLS Online TPP Program

#Question id: 27859

#Research Methodology

Which of the following is not one of the seven major parts to the research report? 

TLS Online TPP Program

#Question id: 92

#SCPH05 I Biotechnology

Monosaccharide derivatives in which an amino group replaces one of the hydroxyl groups may have important roles in

TLS Online TPP Program

#Question id: 4574

#SCPH28 | Zoology

Ichthyosaurs were aquatic dinosaurs. Fossils show us that they had dorsal fins and tails, as do fish, even though their closest relatives were terrestrial reptiles that had neither dorsal fins nor aquatic tails. The dorsal fins and tails of ichthyosaurs and fish are

TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.