In above experiment in figure.A two differently positioned blastula cells are specified to become distinct muscle and neuronal cells.In figure.B when These two different blastula cells are placed together in culture. Following results are obtained according to step(1) and step(2). Which statement is correct about muscle cell commitment?

 

TLS Online TPP Program

#Question id: 5589

#SCPH01 Biochemistry

The outer coating of a pollen grain or spore is called as

TLS Online TPP Program

#Question id: 1390

#SCPH05 I Biotechnology

Which of the following statements describes the events of apoptosis?

TLS Online TPP Program

#Question id: 14134

#SCPH01 Biochemistry

PAM stands for ___

TLS Online TPP Program

#Question id: 13096

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 421

#I Life Science/ Life Sciences Group – I-V

The flow of material through a metabolic pathway is called the ________