Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 43485
TLS Online TPP Program

#Question id: 5131

Differentiated cells express the genes and proteins characteristic of their final identity in the adult, and that identity can be altered only under special circumstances. How does the concept of differentiation, as described here, differ from the concept of determination?

#SCPH01 Biochemistry

  1. Determined cells have begun to differentiate, but are not fully differentiated.

  2. Determined cells are embryonic cells that will give rise to all the cell types of the adult organism, but have not yet begun to express the genes and proteins characteristic of their final fates.

  3. Determined cells will continue to follow their fate if grafted into a different place in a host embryo, even though they do not yet express the genes and proteins characteristic of their final fate.

  4. Determined cells are embryonic cells that will form certain cell types and structures if development is allowed to proceed normally, but will alter their development in response to their location if transplanted to a different place in a host embryo.

More Questions
TLS Online TPP Program

#Question id: 10584

#SCPH06 I Botany

The logistic equation above is used to describe the rate of change of a population, N, with time, t, where r is the intrinsic rate of increase and K is the carrying capacity. Which of the following statements is true for this equation?
TLS Online TPP Program

#Question id: 1594

#SCPH05 I Biotechnology

HIV targets include all of the following except
TLS Online TPP Program

#Question id: 13096

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program

#Question id: 5551

#SCPH06 I Botany

When the vertebrate embryo grows into a hollow ball, it is called a
TLS Online TPP Program

#Question id: 587

#I Life Science/ Life Sciences Group – I-V

The concentrations of enzymes are determined by using pseudo first-order conditions in which