Which technique is commonly used for gene knock-out in mice?

TLS Online TPP Program

#Question id: 3002

#I Life Science/ Life Sciences Group – I-V

Cells are most sensitive to penicillin during which phase of the growth curve?

TLS Online TPP Program

#Question id: 15620

#SCPH06 I Botany

Wild type E. coli metabolizes the sugar lactose by expressing the enzyme ß-galactosidase. You have isolated a mutant that you call lac1–, which cannot synthesize ß-galactosidase and cannot grow on lactose (Lac–). During an condition Lac– strain, called lac3–, is linked to the Tn5 insertion. From a strain carrying the Tn5 insertion and lac3– mutation you isolate an F’ that caries a region of the chromosome that includes both Tn5 and the linked Lac region. Introduce this F’ into an F– strain carrying lac1– by selecting for Kanr. These merodiploids express ß-galactosidase normally. What does this result tell you about the relationship between the lac3– and lac1- mutations?  

TLS Online TPP Program

#Question id: 15928

#SCPH05 I Biotechnology

Name the cell line of the human embryonic lung?

TLS Online TPP Program

#Question id: 33

#SCPH28 | Zoology

Use the following figure to answer the question. The figure shows the structures of glucose and fructose. These two molecules differ in the

TLS Online TPP Program

#Question id: 13101

#SCPH05 I Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?