TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 18687
#SCPH05 I Biotechnology
Homology modeling involves
TLS Online TPP Program
#Question id: 14118
#I Life Science/ Life Sciences Group – I-V
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 11542
#I Life Science/ Life Sciences Group – I-V
Different body cells can respond differently to the same polypeptide hormones because ________.
TLS Online TPP Program
#Question id: 3483
#SCPH28 | Zoology
Which of the following statements about evolution of behavior is correct?
A) Natural selection will favor behavior that enhances survival and reproduction.
B) An animal may show behavior that maximizes reproductive fitness.
C) If a behavior is less than optimal, it is not completely evolved but will eventually,become optimal.
TLS Online TPP Program
#Question id: 12751
#SCPH06 I Botany
A DNA sample has a 260/280 ratio of 2. Which of the following treatments can be used to get a better purity of DNA sample?