Lac Operon will be turned on when

TLS Online TPP Program

#Question id: 4982

#SCPH28 | Zoology

Bagworm moth caterpillars feed on evergreens and carry a silken case or bag around with them in which they eventually pupate. Adult female bagworm moths are larval in appearance; they lack the wings and other structures of the adult male and instead retain the appearance of a caterpillar even though they are sexually mature and can lay eggs within the bag. This is a good example of

TLS Online TPP Program

#Question id: 347

#I Life Science/ Life Sciences Group – I-V

A beaker contains 100 milliliters (mL) of NaOH solution at pH = 13. A technician carefully pours into the beaker 10 mL of HCl at pH = 1. Which of the following statements correctly describes the result of this mixing?

TLS Online TPP Program

#Question id: 2619

#SCPH01 Biochemistry

CAP and the Lac repressor; Which one is incorrect about this.

TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 2266

#SCPH01 Biochemistry

In bacteria, some of the functions of eukaryotic cells are performed