Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 44413
TLS Online TPP Program

#Question id: 2986

During ubiquitin-mediated protein degradation in various events of cell cycle, ubiquitin-protein ligases ubiquitinylate substrate proteins, marking them for degradation by proteasomes. Cyclins are degraded through the action of two different ubiquitin-protein ligases, SCF and the anaphase-promoting complex or cyclosome. Following statements are regarding to SCF and APC/C.

A. SCF controls the G1–S phase transition by degrading G1/S phase cyclins and, CDK inhibitory proteins.

B. APC/C degrades S phase and mitotic cyclins, thereby promoting the exit from mitosis.

C. SCF and APC/C are multi-subunit ubiquitin-protein ligases that belong to the RING finger family of ubiquitin protein ligases.

D. SCF and APC/C belong to the different ubiquitin-protein ligase family, their regulation is same.

E. SCF recognizes its substrates only when they are phosphorylated.

F. SCF and APC/C both recognizes its substrates only when they are phosphorylated.

Which of the following is incorrect?

#SCPH06 I Botany

  1. A, B, C and E

  2. B, D and F

  3. B, C and E

  4. D and F only

More Questions
TLS Online TPP Program

#Question id: 11664

#I Life Science/ Life Sciences Group – I-V

Why are the renal artery and vein critical to the process of osmoregulation in vertebrates?
TLS Online TPP Program

#Question id: 14207

#SCPH05 I Biotechnology

Calculate the adsorption of a dye on activated carbon at 25°C, where k = 0.025, n = 0.5 and C = 0.04.Based on the Freundlich isotherm
TLS Online TPP Program

#Question id: 13096

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program

#Question id: 16475

#SCPH01 Biochemistry

Cultures that facilitate cell-to-cell interactions and signaling among cells and allow their study, are
TLS Online TPP Program

#Question id: 3453

#SCPH06 I Botany

The degree of genetic relatedness between the offspring and their parents is