Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 44632
TLS Online TPP Program

#Question id: 4325

Cell differentiation always involves

#SCPH06 I Botany

  1. transcription of the myo D gene.

  2. the movement of cells.

  3. the production of tissue-specific proteins.

  4. the selective loss of certain genes from the genome.

More Questions
TLS Online TPP Program

#Question id: 758

#SCPH05 I Biotechnology

Both miRNAs and one strand of siRNAs are bound by proteins to form a ribonucleoprotein complex called:
TLS Online TPP Program

#Question id: 432

#SCPH01 Biochemistry

The ultimate product of complete oxidation of carbohydrates is ________.
TLS Online TPP Program

#Question id: 12668

#SCPH06 I Botany

What will be the effect of  water deficit condition in the plant cell?
TLS Online TPP Program

#Question id: 10389

#SCPH06 I Botany

The amount of light absorb by the plant per square meter (µmol m–2) known as
TLS Online TPP Program

#Question id: 13095

#SCPH01 Biochemistry

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.