TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14362
#SCPH05 I Biotechnology
An experiment requires the use of 5 x 107 units of enzyme. The price for the enzyme is quoted for katal amounts. Allowing for a 20% excess for wastage, pipetting, and so forth, what approximate round number of katals of enzyme would you purchase?
TLS Online TPP Program
#Question id: 7303
#SCPH28 | Zoology
The ‘quartet model’ explains how the protein products of the ABCE-function genes might interact to control floral organ identity. Following statements are based on this model. Which one of them is incorrect?
TLS Online TPP Program
#Question id: 7301
#SCPH01 Biochemistry
An Rajasthani hunter was worried about being attacked by grizzly tigers, so he left the lights in his cabin on all the time. Plants near the cabin flowered a month early. Which of the following best explains this?
TLS Online TPP Program
#Question id: 13032
#SCPH01 Biochemistry
In SDS-PAGE, protein sample is first treated with detergent sodium dodecyl sulfate (SDS), in order to
TLS Online TPP Program
#Question id: 13100
#SCPH01 Biochemistry
You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?