A plant scientist was hired by a greenhouse operator to devise a way to force iris plants to bloom in the short days of winter. Iris normally blooms as a long-day (short-night) plant. Which of the following has the best chance of creating iris blooms in winter?

TLS Online TPP Program

#Question id: 1403

#SCPH05 I Biotechnology

Tumor-suppressor genes encode proteins with which of the following functions?

a. growth-promoting               b. growth-arresting                  c. pro-apoptotic

d. anti-apoptotic                      e. DNA repair

TLS Online TPP Program

#Question id: 5604

#SCPH01 Biochemistry

Upon secretion of wnt, When Wnt attaches to the Frizzled receptor on a responding cell, the cell secretes Notum, cleaves off Wnt’s attached lipids. This process is called as:

TLS Online TPP Program

#Question id: 1083

#SCPH28 | Zoology

 When a neuron responds to a particular neurotransmitter by opening gated ion channels, the neurotransmitter is serving as which part of the signal pathway?

TLS Online TPP Program

#Question id: 14118

#SCPH05 I Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 810

#SCPH01 Biochemistry

Which of the following statements concerning the process of spontaneous folding of proteins is false?