What is true of the amino acids that might have been delivered to Earth within carbonaceous chondrites?

TLS Online TPP Program

#Question id: 13096

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 13097

#SCPH01 Biochemistry

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six?

TLS Online TPP Program

#Question id: 13097

#SCPH05 I Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six?

TLS Online TPP Program

#Question id: 13097

#SCPH06 I Botany

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six?

TLS Online TPP Program

#Question id: 13097

#SCPH28 | Zoology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

If you take any bacterial gene sequence, before you begin doing any sequence analysis on it, there are six potential open reading frames. Why are there six?

TLS Online TPP Program

#Question id: 13098

#SCPH01 Biochemistry

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

How many of the 6 potential open reading frames are actually open in this sequence shown above?