TLS Online TPP Program

#Question id: 4970


If two continental land masses converge and are united, then the collision should cause

#SCPH06 I Botany
  1. a net loss of intertidal zone and coastal habitat.

  2. the extinction of any species adapted to intertidal and coastal habitats.

  3. an overall decrease in the surface area located in the continental interior.

  4. a decrease in climatic extremes in the interior of the new super-continent.

More Questions
TLS Online TPP Program

#Question id: 13100

#SCPH06 I Botany

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 7752

#SCPH01 Biochemistry

The autophagy pathway included____
a) the catabolic mechanism that delivers cellular components to lysosomes, where they are degraded
b) Autophagy protects the cell from the harmful or lethal effects of damaged or unnecessary proteins and organelles
c) During starvation, the autophagic breakdown and recycling of cellular components also
ensure cellular survival by maintaining cellular energy levels
Which of the following are the correct prediction about autophagy is true?

TLS Online TPP Program

#Question id: 5523

#I Life Science/ Life Sciences Group – I-V

Ectodermal cells condense into placodes that change into

TLS Online TPP Program

#Question id: 9162

#SCPH28 | Zoology

If the direction of Earth's rotation reversed, the most predictable effect would be ________.

TLS Online TPP Program

#Question id: 10548

#SCPH05 I Biotechnology

flg22-elicited response is dependent on the presence of the LRR receptor-like kinase, what will be the causes of mutant form of LRR receptor-like kinase FLS2?