The proximate causes of behavior are interactions with the environment, but behavior is ultimately shaped by

TLS Online TPP Program

#Question id: 3869

#SCPH28 | Zoology

Which one of the following statements about E. coli RNA polymerase (core enzyme) is false?

TLS Online TPP Program

#Question id: 13100

#SCPH05 I Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 676

#SCPH28 | Zoology

What would you expect about the formation of an α-helix for a segment of a protein chain that contains lysine approximately every fourth residue with all other residues being mostly hydrophobic?

TLS Online TPP Program

#Question id: 5220

#SCPH06 I Botany

In comparing the genomes of humans and those of other higher primates, it is seen that humans have a large metacentric pair we call chromosome #2 among our 46 chromosomes, while the other primates of this group have 48 chromosomes and any pair like the human #2 pair is not present; instead the primate groups each have two pairs of midsize acrocentric chromosomes. What is the most likely explanation?

TLS Online TPP Program

#Question id: 3699

#SCPH28 | Zoology

In this diagram of the process of DNA replication at a replication fork, the black boxes labeled D and E are: