TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 17674
#SCPH12 I Genetics
In humans, albinism (unpigmented skin, hair, and eyes) is due to an enzymatic deficiency, and it is an autosomal recessive trait. Suppose that in a small country of one million people (“Generation 1”), there are 500 aa albinos and 9000 Aa heterozygous carriers. Has the frequency of allele a changed between Generations 1 and 2?
TLS Online TPP Program
#Question id: 18368
#SCPH28 | Zoology
The Phytoremediation system can be used for the treatment of
TLS Online TPP Program
#Question id: 14118
#SCPH05 I Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 27855
#Research Methodology
A comprehensive full Report of the research process is called
TLS Online TPP Program
#Question id: 14290
#SCPH05 I Biotechnology
Acetobacter aceti converts alcohol to acetic acid according to the schiometric relation
In a vigorously agitated and aerated reactor containing 20 g/l ethanol, the organism produces 16g/l acetic acid and 2g/l was the residual ethanol concentration what are the theoretical and observed yields of acetic acid expressed in g/g ethanol