Practice Questions

TLS Online TPP Program

#Question id: 12946

Choose the incorrect statement for the Multiple Ligation dependent probe amplification.

#SCPH06 I Botany

In this method two hybridization probes are used.
One containing a forward PCR primer sequence labelled with a fluorescent dye.
Other with a stuffer sequence and reverse primer sequence.
If ligation takes place then PCR amplification cannot proceed.

More Questions

TLS Online TPP Program

#Question id: 3620

#SCPH28 | Zoology

Which of the following word is a short form of allelomorph?

TLS Online TPP Program

#Question id: 4597

#SCPH28 | Zoology

Cotton-topped tamarins are small primates with tufts of long white hair on their heads. While studying these creatures, you notice that males with longer hair get more opportunities to mate and father more offspring. To test the hypothesis that having longer hair is adaptive in these males, you should ________.

TLS Online TPP Program

#Question id: 13101

#SCPH05 I Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program