TLS Online TPP Program

#Question id: 13096


You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

#SCPH06 I Botany
  1. 64 different primers
  2. 32 different primers
  3. 36 different primers
  4. 16 different primers
More Questions
TLS Online TPP Program

#Question id: 8699

#SCPH06 I Botany

Use the figure to answer the following question.

If the figure is an accurate depiction of relatedness, then which of the following should be an accurate statement?

TLS Online TPP Program

#Question id: 8699

#SCPH28 | Zoology

Use the figure to answer the following question.

If the figure is an accurate depiction of relatedness, then which of the following should be an accurate statement?

TLS Online TPP Program

#Question id: 8700

#SCPH06 I Botany

Use the following figure and description to answer the question.

Humans, chimpanzees, gorillas, and orangutans are members of a clade called the great apes, which shared a common ancestor about 15 million years ago. Gibbons and siamangs comprise a clade called the lesser apes. Tree-branch lengths indicate elapsed time. Assuming chimps and gorillas are humans' closest relatives, removing humans from the great ape clade and placing them in a different clade has the effect of making the phylogenetic tree of the great apes ________.

TLS Online TPP Program

#Question id: 8700

#SCPH28 | Zoology

Use the following figure and description to answer the question.

Humans, chimpanzees, gorillas, and orangutans are members of a clade called the great apes, which shared a common ancestor about 15 million years ago. Gibbons and siamangs comprise a clade called the lesser apes. Tree-branch lengths indicate elapsed time. Assuming chimps and gorillas are humans' closest relatives, removing humans from the great ape clade and placing them in a different clade has the effect of making the phylogenetic tree of the great apes ________.

TLS Online TPP Program

#Question id: 8701

#SCPH06 I Botany

The question refers to the following table, which compares the percent sequence homology of four different parts (two introns and two exons) of a gene that is found in five different eukaryotic species. Each part is numbered to indicate its distance from the promoter (for example, Intron I is the one closest to the promoter). The data reported for species A were obtained by comparing DNA from one member of species A to another member of species A.


Based on the tabular data, and assuming that time advances vertically, which phylogenetic tree is the most likely depiction of the evolutionary relationships among these five species?

TLS Online TPP Program

#Question id: 8701

#SCPH28 | Zoology

The question refers to the following table, which compares the percent sequence homology of four different parts (two introns and two exons) of a gene that is found in five different eukaryotic species. Each part is numbered to indicate its distance from the promoter (for example, Intron I is the one closest to the promoter). The data reported for species A were obtained by comparing DNA from one member of species A to another member of species A.


Based on the tabular data, and assuming that time advances vertically, which phylogenetic tree is the most likely depiction of the evolutionary relationships among these five species?