You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 800

#SCPH05 I Biotechnology

Following table lists the two major forms of DNA duplexes, conformation of base attached to the sugar and the nature of major and minor grooves.

#Question id: 801

#SCPH05 I Biotechnology

Identify the type of DNA from the structures given below and match the correct form with its characteristics described.

#Question id: 802

#SCPH05 I Biotechnology

A single-stranded DNA molecule contains 40 nucleotides with equal amounts of A, C, G, and T. This DNA strand can combine with a complementary DNA strand to form a double-stranded DNA molecule. Which is a possible sequence and structure for this DNA molecule?

#Question id: 803

#SCPH05 I Biotechnology

A single-stranded DNA molecule contains 40 nucleotides and has the sequence 5’-(GA)20-3’. When this single strand binds to a complementary DNA strand to form a B-DNA structure,

#Question id: 804

#SCPH05 I Biotechnology

With respect to microRNAs, which, if any, of the following statements, is false?

a) A microRNA normally works by binding to perfectly complementary sequences within an RNA transcript, usually an mRNA.

b) Like the great majority of mRNAs an miRNA is usually produced as a larger precursor RNA that is capped and has a 3’ poly(A) tail.

c) The precursor miRNA undergoes different types of post-transcriptional cleavage by endoribonucleases that are specific for double-stranded target sequences.

d) A nuclear endoribonuclease called dicer cleaves the miRNA precursor so that it forms a stem-loop RNA.

#Question id: 805

#SCPH05 I Biotechnology

miRNAs are encoded in the genome as segments of longer transcripts. Their characteristic structure helps identify them and predict the target genes they might regulate. Which of the following are the characteristic features of these small RNA molecules?

I. The functional form of an miRNA is typically 21 or 22 nucleotides (it can vary from 19 to 25 nucleotides).

II. The first cleavage liberates the stem-loop, called the pre-miRNA; the second generates the mature miRNA from the pre-miRNA.

III. The pre-miRNAs can be encoded by any part of a transcript: that is, they might fall within coding regions, within leader regions, or within Introns.

IV. The base pairing between miRNA and target RNA is initiated by interactions of so-called seed residues—the sequence between bases 2 and 9 of the 22-nucleotide miRNA.