Name the agar plate method which is most common gel based assay system used in Agglutination process.

TLS Online TPP Program

#Question id: 5431

#SCPH06 I Botany

Plant having height 6 cm are allowed to cross with plant having height 2 cm , all F1 progeny having height uniform 4 cm were allowed selfing to produced F2 progeny in which 3 plant out of  8 having height  4 cm . what are number of polygene involve in that trait ?

TLS Online TPP Program

#Question id: 4160

#SCPH05 I Biotechnology

Different tRNA molecules that bind the same amino acid are called __ tRNA molecules.

TLS Online TPP Program

#Question id: 13101

#SCPH06 I Botany

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 19341

#SCPH06 I Botany

________ is a device which detects the changes in temperature?

TLS Online TPP Program

#Question id: 4341

#SCPH06 I Botany

Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If a researcher moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene, which of the following results would be most likely?