TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 1737
#I Life Science/ Life Sciences Group – I-V
The carrier T-cell epitope on a thymus-dependent antigen:
TLS Online TPP Program
#Question id: 13063
#SCPH05 I Biotechnology
Precision will be reduced, but yield will be increased
Optimisation of a PCR reaction is often a compromise between the competing demands for precision, efficiency and yield. Although the specific effects may vary, generally, increasing the annealing temperature will increase non-specific primer binding and reduce precision. Increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield. In this case, the potential effect on efficiency is unclear. Increasing the elongation phase would increase the reaction time, but the time taken to ramp down to a lower annealing temperature would be reduced.
Which of the statement is worng? Aminopetrin………s
TLS Online TPP Program
#Question id: 13096
#SCPH28 | Zoology
You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?
TLS Online TPP Program
#Question id: 10590
#SCPH06 I Botany
Which of the following is correct figure?
TLS Online TPP Program
#Question id: 15615
#SCPH06 I Botany
The three stop codons are (I) 5’UAG3’, (II) 5’UAA3’, and (III) 5’UGA3’. when mutagens that specifically induce G•C to A•T mutations on 5’, then what will be the result?