TLS Online TPP Program

#Question id: 18392


How Deinococcus radiodurans are naturally resistant to quite high levels of ionizing radiation

#SCPH06 I Botany
  1. Due to high mutation rate which changes the organism variant
  2. Due to high transcription rate
  3. Due to high DNA repair processes that are exceptionally effective at repairing DNA damage
  4. Due to high apoptosis rate in bacteria
More Questions
TLS Online TPP Program

#Question id: 5544

#SCPH28 | Zoology

Which embryonic membrane forms the commonly of the placenta?

TLS Online TPP Program

#Question id: 14118

#I Life Science/ Life Sciences Group – I-V

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 10503

#I Life Science/ Life Sciences Group – I-V

A Pseudomonas species that synthesizes the antifungal compound against the pathogenic fungus Gaeumannomyces graminis known as

TLS Online TPP Program

#Question id: 10522

#SCPH05 I Biotechnology

Mechanical barriers provide a first line of defence against insect pests and pathogens, these mechanical barriers developed by plants;

                   COLUMN A  

                     COLUMN B

A. Thorns

i) It can be found on the stem and petioles of roses and are formed by the epidermis

B. Spines

ii) Found on a lemon tree (Citrus sp.) are modified branches, as can be seen by their position in the axil of a leaf

C. Prickles

iii) Found on shoot and leaves of tomato (Solanum lycopersicum) are derived from epidermal cells

D. Trichomes

iv) which are characteristic of cacti (Opuntia spp.) in the New World, are modified leaves

Match correctly following combination of barrier developed by plants ;

TLS Online TPP Program

#Question id: 10690

#SCPH06 I Botany

Which of following interaction shown in following species of Paramecium?