What kind of physical changes can be detected in biosensor?

A. Production of gas such as oxygen, hydrogen, etc.

B.  Change in mass of the biological component

C. Light produced or absorbed in reaction

Which of the following above statements are correct?

TLS Online TPP Program

#Question id: 13096

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 745

#SCPH28 | Zoology

The structure of RNA differs from that of DNA, as RNA contains:

TLS Online TPP Program

#Question id: 14154

#SCPH01 Biochemistry

BLAST and FASTA are the examples of 

TLS Online TPP Program

#Question id: 2616

#SCPH28 | Zoology

Normally expression is always consider with the, transcription most of the regulation applied over transcriptional initiation in prokaryotes, why

TLS Online TPP Program

#Question id: 10716

#SCPH28 | Zoology

The stability of a food web in a community is quantified using certain parameters which are defined below. Which of the following is an CORRECT representation?

A. Community with more complex is more stable

B. Community with more number of alternate is more stable

C. Stability of community is inversely proportional to Connectance 

D. Community with higher value of dominax index is more stable