Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 47179
TLS Online TPP Program

#Question id: 52

Choose the incorrect option regarding Isomerism.

#SCPH28 | Zoology

  1. They differ in both physical and chemical properties

  2. They have the different molecular formula

  3. There are two types of Isomerism: Structural and Stereo Isomerism

  4. Geometric and optical isomerism are two types of Stereo Isomerism

More Questions
TLS Online TPP Program

#Question id: 1692

#SCPH05 I Biotechnology

The processing of cytosolic protein involves:
TLS Online TPP Program

#Question id: 13095

#SCPH06 I Botany

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.
TLS Online TPP Program

#Question id: 3897

#SCPH05 I Biotechnology

Gene silencing by RNA interference acts by of the target gene.
TLS Online TPP Program

#Question id: 7754

#I Life Science/ Life Sciences Group – I-V

In autophagy, the endoplasmic reticulum (ER) first gives rise to a cup-shaped, membranous cisterna called the
TLS Online TPP Program

#Question id: 18902

#SCPH01 Biochemistry

which of the following radioactive element Used to treat cancerous tumours