________ catalyze the hydrolysis of phosphodiester linkages to release nucleotide residues from only one end of a polypeptide chain.

TLS Online TPP Program

#Question id: 13095

#SCPH28 | Zoology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 8290

#SCPH06 I Botany

If, someday, an archaean cell is discovered whose rRNA sequence is more similar to that of humans than the sequence of mouse rRNA is to that of humans, the best explanation for this apparent discrepancy would be ________.

TLS Online TPP Program

#Question id: 12948

#SCPH28 | Zoology

Proteolytic cleavage of DNA polymerase by subtilisin caused loss of its nick translation activity. Which of the following properties is lost?

TLS Online TPP Program

#Question id: 312

#SCPH28 | Zoology

The type of molecules that forms the aggregate through a self-assembly process which is driven by the hydrophobic effect is _______

TLS Online TPP Program

#Question id: 2657

#SCPH05 I Biotechnology

In Lac-operon, the gene product of LacA gene is